ID: 1153149505

View in Genome Browser
Species Human (GRCh38)
Location 18:2074880-2074902
Sequence ATTTTGGCCTGTGGTATCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153149505_1153149508 29 Left 1153149505 18:2074880-2074902 CCAGTGATACCACAGGCCAAAAT No data
Right 1153149508 18:2074932-2074954 CATCAATTGATCTGAATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153149505 Original CRISPR ATTTTGGCCTGTGGTATCAC TGG (reversed) Intergenic
No off target data available for this crispr