ID: 1153151285

View in Genome Browser
Species Human (GRCh38)
Location 18:2096411-2096433
Sequence CAAGAGTAGATCAAGGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153151280_1153151285 20 Left 1153151280 18:2096368-2096390 CCACCCTGAAAGGAAATGAAGTG No data
Right 1153151285 18:2096411-2096433 CAAGAGTAGATCAAGGAGACTGG No data
1153151281_1153151285 17 Left 1153151281 18:2096371-2096393 CCCTGAAAGGAAATGAAGTGTGA No data
Right 1153151285 18:2096411-2096433 CAAGAGTAGATCAAGGAGACTGG No data
1153151282_1153151285 16 Left 1153151282 18:2096372-2096394 CCTGAAAGGAAATGAAGTGTGAG No data
Right 1153151285 18:2096411-2096433 CAAGAGTAGATCAAGGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153151285 Original CRISPR CAAGAGTAGATCAAGGAGAC TGG Intergenic
No off target data available for this crispr