ID: 1153151798

View in Genome Browser
Species Human (GRCh38)
Location 18:2104615-2104637
Sequence GTAACAAGTCCCTAAATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153151798_1153151799 20 Left 1153151798 18:2104615-2104637 CCATTTATTTAGGGACTTGTTAC No data
Right 1153151799 18:2104658-2104680 AAAATCTGAAGCTTCTCATTAGG No data
1153151798_1153151800 21 Left 1153151798 18:2104615-2104637 CCATTTATTTAGGGACTTGTTAC No data
Right 1153151800 18:2104659-2104681 AAATCTGAAGCTTCTCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153151798 Original CRISPR GTAACAAGTCCCTAAATAAA TGG (reversed) Intergenic