ID: 1153156894

View in Genome Browser
Species Human (GRCh38)
Location 18:2159909-2159931
Sequence CCTTTATGTGGAGCTTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153156889_1153156894 -8 Left 1153156889 18:2159894-2159916 CCTCCACTGCATAGCCCTTTATG No data
Right 1153156894 18:2159909-2159931 CCTTTATGTGGAGCTTTTACTGG No data
1153156888_1153156894 -7 Left 1153156888 18:2159893-2159915 CCCTCCACTGCATAGCCCTTTAT No data
Right 1153156894 18:2159909-2159931 CCTTTATGTGGAGCTTTTACTGG No data
1153156887_1153156894 -6 Left 1153156887 18:2159892-2159914 CCCCTCCACTGCATAGCCCTTTA No data
Right 1153156894 18:2159909-2159931 CCTTTATGTGGAGCTTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153156894 Original CRISPR CCTTTATGTGGAGCTTTTAC TGG Intergenic
No off target data available for this crispr