ID: 1153159740

View in Genome Browser
Species Human (GRCh38)
Location 18:2190395-2190417
Sequence GAAGTGAAGTTTCAGTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153159740_1153159745 30 Left 1153159740 18:2190395-2190417 CCATTTAACTGAAACTTCACTTC No data
Right 1153159745 18:2190448-2190470 GCCAGTATTTGCTGGGATGCAGG No data
1153159740_1153159743 23 Left 1153159740 18:2190395-2190417 CCATTTAACTGAAACTTCACTTC No data
Right 1153159743 18:2190441-2190463 TCCAGTGGCCAGTATTTGCTGGG No data
1153159740_1153159741 8 Left 1153159740 18:2190395-2190417 CCATTTAACTGAAACTTCACTTC No data
Right 1153159741 18:2190426-2190448 ATGCTTACTGAAATGTCCAGTGG No data
1153159740_1153159742 22 Left 1153159740 18:2190395-2190417 CCATTTAACTGAAACTTCACTTC No data
Right 1153159742 18:2190440-2190462 GTCCAGTGGCCAGTATTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153159740 Original CRISPR GAAGTGAAGTTTCAGTTAAA TGG (reversed) Intergenic
No off target data available for this crispr