ID: 1153160439

View in Genome Browser
Species Human (GRCh38)
Location 18:2198741-2198763
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153160439_1153160443 27 Left 1153160439 18:2198741-2198763 CCCAACTTGTAGTGCTAAATGTA No data
Right 1153160443 18:2198791-2198813 ATTAATCTCTGTATAATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153160439 Original CRISPR TACATTTAGCACTACAAGTT GGG (reversed) Intergenic
No off target data available for this crispr