ID: 1153162354

View in Genome Browser
Species Human (GRCh38)
Location 18:2221837-2221859
Sequence TTCTAGTTTTATATCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153162354_1153162358 12 Left 1153162354 18:2221837-2221859 CCATCCTGGATATAAAACTAGAA No data
Right 1153162358 18:2221872-2221894 GCATTTCTGAGTAGTCCTGAGGG No data
1153162354_1153162361 23 Left 1153162354 18:2221837-2221859 CCATCCTGGATATAAAACTAGAA No data
Right 1153162361 18:2221883-2221905 TAGTCCTGAGGGATGCTGAGGGG No data
1153162354_1153162364 28 Left 1153162354 18:2221837-2221859 CCATCCTGGATATAAAACTAGAA No data
Right 1153162364 18:2221888-2221910 CTGAGGGATGCTGAGGGGCAGGG No data
1153162354_1153162357 11 Left 1153162354 18:2221837-2221859 CCATCCTGGATATAAAACTAGAA No data
Right 1153162357 18:2221871-2221893 GGCATTTCTGAGTAGTCCTGAGG No data
1153162354_1153162363 27 Left 1153162354 18:2221837-2221859 CCATCCTGGATATAAAACTAGAA No data
Right 1153162363 18:2221887-2221909 CCTGAGGGATGCTGAGGGGCAGG No data
1153162354_1153162359 21 Left 1153162354 18:2221837-2221859 CCATCCTGGATATAAAACTAGAA No data
Right 1153162359 18:2221881-2221903 AGTAGTCCTGAGGGATGCTGAGG No data
1153162354_1153162356 -10 Left 1153162354 18:2221837-2221859 CCATCCTGGATATAAAACTAGAA No data
Right 1153162356 18:2221850-2221872 AAAACTAGAAATACTACAAATGG No data
1153162354_1153162360 22 Left 1153162354 18:2221837-2221859 CCATCCTGGATATAAAACTAGAA No data
Right 1153162360 18:2221882-2221904 GTAGTCCTGAGGGATGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153162354 Original CRISPR TTCTAGTTTTATATCCAGGA TGG (reversed) Intergenic
No off target data available for this crispr