ID: 1153170116

View in Genome Browser
Species Human (GRCh38)
Location 18:2306750-2306772
Sequence AGGTATTGCTGAGAATTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153170116_1153170122 18 Left 1153170116 18:2306750-2306772 CCCACTAATTCTCAGCAATACCT No data
Right 1153170122 18:2306791-2306813 CCAAGTGCTCTAAGTTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153170116 Original CRISPR AGGTATTGCTGAGAATTAGT GGG (reversed) Intergenic
No off target data available for this crispr