ID: 1153170628

View in Genome Browser
Species Human (GRCh38)
Location 18:2312017-2312039
Sequence CCTTCTTGACTCCATGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153170628_1153170631 19 Left 1153170628 18:2312017-2312039 CCACAGTCATGGAGTCAAGAAGG No data
Right 1153170631 18:2312059-2312081 CTTGTAGTTTTATGAGTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153170628 Original CRISPR CCTTCTTGACTCCATGACTG TGG (reversed) Intergenic
No off target data available for this crispr