ID: 1153171471

View in Genome Browser
Species Human (GRCh38)
Location 18:2320836-2320858
Sequence CAATAGGTGGAGAGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153171465_1153171471 18 Left 1153171465 18:2320795-2320817 CCATGAAATTGTTCAGAAAAGAG No data
Right 1153171471 18:2320836-2320858 CAATAGGTGGAGAGGCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153171471 Original CRISPR CAATAGGTGGAGAGGCCCTG AGG Intergenic
No off target data available for this crispr