ID: 1153174679

View in Genome Browser
Species Human (GRCh38)
Location 18:2357581-2357603
Sequence CTTGCAGTTCACTGCAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153174679_1153174687 27 Left 1153174679 18:2357581-2357603 CCACTCCTGCAGTGAACTGCAAG No data
Right 1153174687 18:2357631-2357653 CCCAGGCTTAGCCAGGCACCTGG No data
1153174679_1153174683 10 Left 1153174679 18:2357581-2357603 CCACTCCTGCAGTGAACTGCAAG No data
Right 1153174683 18:2357614-2357636 AGCAGTTGTCCTTTATGCCCAGG No data
1153174679_1153174685 20 Left 1153174679 18:2357581-2357603 CCACTCCTGCAGTGAACTGCAAG No data
Right 1153174685 18:2357624-2357646 CTTTATGCCCAGGCTTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153174679 Original CRISPR CTTGCAGTTCACTGCAGGAG TGG (reversed) Intergenic
No off target data available for this crispr