ID: 1153174680

View in Genome Browser
Species Human (GRCh38)
Location 18:2357586-2357608
Sequence AGGAGCTTGCAGTTCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153174680_1153174687 22 Left 1153174680 18:2357586-2357608 CCTGCAGTGAACTGCAAGCTCCT No data
Right 1153174687 18:2357631-2357653 CCCAGGCTTAGCCAGGCACCTGG No data
1153174680_1153174685 15 Left 1153174680 18:2357586-2357608 CCTGCAGTGAACTGCAAGCTCCT No data
Right 1153174685 18:2357624-2357646 CTTTATGCCCAGGCTTAGCCAGG No data
1153174680_1153174683 5 Left 1153174680 18:2357586-2357608 CCTGCAGTGAACTGCAAGCTCCT No data
Right 1153174683 18:2357614-2357636 AGCAGTTGTCCTTTATGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153174680 Original CRISPR AGGAGCTTGCAGTTCACTGC AGG (reversed) Intergenic
No off target data available for this crispr