ID: 1153174682

View in Genome Browser
Species Human (GRCh38)
Location 18:2357606-2357628
Sequence TAAAGGACAACTGCTCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153174682_1153174685 -5 Left 1153174682 18:2357606-2357628 CCTTGAGGAGCAGTTGTCCTTTA No data
Right 1153174685 18:2357624-2357646 CTTTATGCCCAGGCTTAGCCAGG No data
1153174682_1153174692 21 Left 1153174682 18:2357606-2357628 CCTTGAGGAGCAGTTGTCCTTTA No data
Right 1153174692 18:2357650-2357672 CTGGCACATAGCAGTCAGGCAGG No data
1153174682_1153174694 30 Left 1153174682 18:2357606-2357628 CCTTGAGGAGCAGTTGTCCTTTA No data
Right 1153174694 18:2357659-2357681 AGCAGTCAGGCAGGAAAATAGGG No data
1153174682_1153174693 29 Left 1153174682 18:2357606-2357628 CCTTGAGGAGCAGTTGTCCTTTA No data
Right 1153174693 18:2357658-2357680 TAGCAGTCAGGCAGGAAAATAGG No data
1153174682_1153174690 17 Left 1153174682 18:2357606-2357628 CCTTGAGGAGCAGTTGTCCTTTA No data
Right 1153174690 18:2357646-2357668 GCACCTGGCACATAGCAGTCAGG No data
1153174682_1153174687 2 Left 1153174682 18:2357606-2357628 CCTTGAGGAGCAGTTGTCCTTTA No data
Right 1153174687 18:2357631-2357653 CCCAGGCTTAGCCAGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153174682 Original CRISPR TAAAGGACAACTGCTCCTCA AGG (reversed) Intergenic
No off target data available for this crispr