ID: 1153174683

View in Genome Browser
Species Human (GRCh38)
Location 18:2357614-2357636
Sequence AGCAGTTGTCCTTTATGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153174680_1153174683 5 Left 1153174680 18:2357586-2357608 CCTGCAGTGAACTGCAAGCTCCT No data
Right 1153174683 18:2357614-2357636 AGCAGTTGTCCTTTATGCCCAGG No data
1153174679_1153174683 10 Left 1153174679 18:2357581-2357603 CCACTCCTGCAGTGAACTGCAAG No data
Right 1153174683 18:2357614-2357636 AGCAGTTGTCCTTTATGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153174683 Original CRISPR AGCAGTTGTCCTTTATGCCC AGG Intergenic
No off target data available for this crispr