ID: 1153174687

View in Genome Browser
Species Human (GRCh38)
Location 18:2357631-2357653
Sequence CCCAGGCTTAGCCAGGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153174680_1153174687 22 Left 1153174680 18:2357586-2357608 CCTGCAGTGAACTGCAAGCTCCT No data
Right 1153174687 18:2357631-2357653 CCCAGGCTTAGCCAGGCACCTGG No data
1153174679_1153174687 27 Left 1153174679 18:2357581-2357603 CCACTCCTGCAGTGAACTGCAAG No data
Right 1153174687 18:2357631-2357653 CCCAGGCTTAGCCAGGCACCTGG No data
1153174682_1153174687 2 Left 1153174682 18:2357606-2357628 CCTTGAGGAGCAGTTGTCCTTTA No data
Right 1153174687 18:2357631-2357653 CCCAGGCTTAGCCAGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153174687 Original CRISPR CCCAGGCTTAGCCAGGCACC TGG Intergenic
No off target data available for this crispr