ID: 1153174690

View in Genome Browser
Species Human (GRCh38)
Location 18:2357646-2357668
Sequence GCACCTGGCACATAGCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153174684_1153174690 0 Left 1153174684 18:2357623-2357645 CCTTTATGCCCAGGCTTAGCCAG No data
Right 1153174690 18:2357646-2357668 GCACCTGGCACATAGCAGTCAGG No data
1153174686_1153174690 -8 Left 1153174686 18:2357631-2357653 CCCAGGCTTAGCCAGGCACCTGG No data
Right 1153174690 18:2357646-2357668 GCACCTGGCACATAGCAGTCAGG No data
1153174682_1153174690 17 Left 1153174682 18:2357606-2357628 CCTTGAGGAGCAGTTGTCCTTTA No data
Right 1153174690 18:2357646-2357668 GCACCTGGCACATAGCAGTCAGG No data
1153174688_1153174690 -9 Left 1153174688 18:2357632-2357654 CCAGGCTTAGCCAGGCACCTGGC No data
Right 1153174690 18:2357646-2357668 GCACCTGGCACATAGCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153174690 Original CRISPR GCACCTGGCACATAGCAGTC AGG Intergenic
No off target data available for this crispr