ID: 1153174694

View in Genome Browser
Species Human (GRCh38)
Location 18:2357659-2357681
Sequence AGCAGTCAGGCAGGAAAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153174688_1153174694 4 Left 1153174688 18:2357632-2357654 CCAGGCTTAGCCAGGCACCTGGC No data
Right 1153174694 18:2357659-2357681 AGCAGTCAGGCAGGAAAATAGGG No data
1153174682_1153174694 30 Left 1153174682 18:2357606-2357628 CCTTGAGGAGCAGTTGTCCTTTA No data
Right 1153174694 18:2357659-2357681 AGCAGTCAGGCAGGAAAATAGGG No data
1153174684_1153174694 13 Left 1153174684 18:2357623-2357645 CCTTTATGCCCAGGCTTAGCCAG No data
Right 1153174694 18:2357659-2357681 AGCAGTCAGGCAGGAAAATAGGG No data
1153174686_1153174694 5 Left 1153174686 18:2357631-2357653 CCCAGGCTTAGCCAGGCACCTGG No data
Right 1153174694 18:2357659-2357681 AGCAGTCAGGCAGGAAAATAGGG No data
1153174689_1153174694 -6 Left 1153174689 18:2357642-2357664 CCAGGCACCTGGCACATAGCAGT No data
Right 1153174694 18:2357659-2357681 AGCAGTCAGGCAGGAAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153174694 Original CRISPR AGCAGTCAGGCAGGAAAATA GGG Intergenic
No off target data available for this crispr