ID: 1153174763

View in Genome Browser
Species Human (GRCh38)
Location 18:2358236-2358258
Sequence GAGGGTTGCAAGAAAGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153174763_1153174768 0 Left 1153174763 18:2358236-2358258 CCCTCACCTTTCTTGCAACCCTC No data
Right 1153174768 18:2358259-2358281 TCAACTGACATCATTTGTCTTGG No data
1153174763_1153174771 5 Left 1153174763 18:2358236-2358258 CCCTCACCTTTCTTGCAACCCTC No data
Right 1153174771 18:2358264-2358286 TGACATCATTTGTCTTGGTGGGG No data
1153174763_1153174769 3 Left 1153174763 18:2358236-2358258 CCCTCACCTTTCTTGCAACCCTC No data
Right 1153174769 18:2358262-2358284 ACTGACATCATTTGTCTTGGTGG No data
1153174763_1153174770 4 Left 1153174763 18:2358236-2358258 CCCTCACCTTTCTTGCAACCCTC No data
Right 1153174770 18:2358263-2358285 CTGACATCATTTGTCTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153174763 Original CRISPR GAGGGTTGCAAGAAAGGTGA GGG (reversed) Intergenic
No off target data available for this crispr