ID: 1153176669

View in Genome Browser
Species Human (GRCh38)
Location 18:2382184-2382206
Sequence CTTGAAGCCCAGTGGGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153176669_1153176674 9 Left 1153176669 18:2382184-2382206 CCTGAAACCCACTGGGCTTCAAG No data
Right 1153176674 18:2382216-2382238 AACCAGCAGGTTGCCCTGCTTGG No data
1153176669_1153176672 -4 Left 1153176669 18:2382184-2382206 CCTGAAACCCACTGGGCTTCAAG No data
Right 1153176672 18:2382203-2382225 CAAGCTTTGCCGTAACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153176669 Original CRISPR CTTGAAGCCCAGTGGGTTTC AGG (reversed) Intergenic
No off target data available for this crispr