ID: 1153179189

View in Genome Browser
Species Human (GRCh38)
Location 18:2413659-2413681
Sequence GGTGAGCCCCAAGACTGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153179182_1153179189 29 Left 1153179182 18:2413607-2413629 CCTGTAGGGTAGGGGCTGAAGCA No data
Right 1153179189 18:2413659-2413681 GGTGAGCCCCAAGACTGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153179189 Original CRISPR GGTGAGCCCCAAGACTGCAC AGG Intergenic