ID: 1153183855

View in Genome Browser
Species Human (GRCh38)
Location 18:2465798-2465820
Sequence TTTCAGTCAGAGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153183855_1153183859 -6 Left 1153183855 18:2465798-2465820 CCCTTCTCCATCTCTGACTGAAA No data
Right 1153183859 18:2465815-2465837 CTGAAAGGATCTTTAAAAGCAGG No data
1153183855_1153183860 5 Left 1153183855 18:2465798-2465820 CCCTTCTCCATCTCTGACTGAAA No data
Right 1153183860 18:2465826-2465848 TTTAAAAGCAGGTGAGCATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153183855 Original CRISPR TTTCAGTCAGAGATGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr