ID: 1153184260

View in Genome Browser
Species Human (GRCh38)
Location 18:2469410-2469432
Sequence CCAAAACCAGAGGTGGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153184255_1153184260 -8 Left 1153184255 18:2469395-2469417 CCACCAGCACTGAGGCCAAAACC No data
Right 1153184260 18:2469410-2469432 CCAAAACCAGAGGTGGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153184260 Original CRISPR CCAAAACCAGAGGTGGTTCA AGG Intergenic
No off target data available for this crispr