ID: 1153190198

View in Genome Browser
Species Human (GRCh38)
Location 18:2529512-2529534
Sequence GTGTCTATAAAAAAGCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153190198_1153190199 5 Left 1153190198 18:2529512-2529534 CCAGGAGGCTTTTTTATAGACAC No data
Right 1153190199 18:2529540-2529562 ATCTGATCCTAAAATTTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153190198 Original CRISPR GTGTCTATAAAAAAGCCTCC TGG (reversed) Intergenic
No off target data available for this crispr