ID: 1153203102

View in Genome Browser
Species Human (GRCh38)
Location 18:2666666-2666688
Sequence GAGTGTTTCAAATGAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153203100_1153203102 5 Left 1153203100 18:2666638-2666660 CCTGTGATAGTTTAACTTATTAA 0: 1
1: 0
2: 2
3: 23
4: 207
Right 1153203102 18:2666666-2666688 GAGTGTTTCAAATGAATGGAAGG 0: 1
1: 0
2: 0
3: 24
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153203102 Original CRISPR GAGTGTTTCAAATGAATGGA AGG Intronic
900828685 1:4948495-4948517 GAGATTTTGAAATGAAAGGAAGG - Intergenic
901389269 1:8932809-8932831 TAGTGTTAGAAATGATTGGAAGG - Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
909079661 1:71094374-71094396 ATGTGCTTCAAATGAATGGGAGG - Intergenic
911653859 1:100420683-100420705 GTGTGTTTAAAAAGAATGAATGG + Intronic
913452928 1:119004355-119004377 GAGAGTTGCAAAGGAATGTACGG + Intergenic
913495678 1:119426200-119426222 GAGTGCTTCGAATGAGGGGAGGG + Intergenic
916696254 1:167239775-167239797 GTGTTTTTCAAATGGATGGCCGG - Intronic
917577239 1:176336414-176336436 GAGTGTGGCAAATGGATGGAGGG + Intergenic
917594049 1:176509667-176509689 TAGAGTTTCAGAAGAATGGAGGG + Intronic
917612906 1:176707366-176707388 GCCTTTTTCAAATGGATGGATGG - Intronic
921390939 1:214612900-214612922 GACTGTTTAAATTGAATGGGGGG + Intronic
921722464 1:218488403-218488425 ATGTGTTTCGAATGAATGAAGGG + Intergenic
922309517 1:224374998-224375020 CAGTATTTCAAAGGAAAGGATGG + Intronic
923326305 1:232883308-232883330 GATTGATTGAAATGAATGAATGG + Intergenic
924930215 1:248724483-248724505 GTGGGTTTCAAATGCAGGGATGG + Intronic
1063374312 10:5544958-5544980 GAGAGTTTCATTTCAATGGAAGG - Intergenic
1063651420 10:7941449-7941471 AAGTGTTTCCAGTGAATGGCTGG + Intronic
1063865197 10:10356929-10356951 ATGTGTTTCAAAATAATGGATGG - Intergenic
1064275809 10:13903903-13903925 GAGTGAATAAAATGAATGAATGG + Intronic
1064576727 10:16753453-16753475 CTGTGTTACAAATTAATGGAAGG + Intronic
1068014396 10:51497323-51497345 GTGTTTATCAAATGATTGGATGG - Intronic
1068577938 10:58705869-58705891 GAGTATTTGAAATTATTGGAAGG + Intronic
1068753692 10:60625799-60625821 AAGTTTTTCAAAAGAATGCATGG + Intronic
1068964788 10:62901281-62901303 GAGGGTTTCAAATCAGTGGGAGG - Intronic
1072425985 10:95331277-95331299 GAGTGAATGAAATGAATGCAGGG - Intronic
1073618561 10:105023414-105023436 GAGAGTTTCCAATGGTTGGAGGG + Intronic
1074089663 10:110237381-110237403 GAGTTTTTATCATGAATGGATGG + Intronic
1074289601 10:112128369-112128391 GAGTCTCCCCAATGAATGGAAGG + Intergenic
1078567404 11:12428302-12428324 GAGTCTCTCATATGAAAGGAGGG + Intronic
1078879389 11:15433213-15433235 GAGTGTTAAAAAAAAATGGAGGG + Intergenic
1079016062 11:16869974-16869996 AACTGTCTCAGATGAATGGAAGG + Intronic
1081261072 11:40961820-40961842 GTTTTTTTAAAATGAATGGATGG - Intronic
1088862710 11:113817117-113817139 GATTGTTGCACATGACTGGATGG + Intronic
1091618773 12:2069703-2069725 GAGTATTTCAAAGGGATTGATGG + Intronic
1093496847 12:19767512-19767534 GAGTTTTTAACATGAAAGGATGG - Intergenic
1093999828 12:25683304-25683326 GAACGTTTCAAATGACTGGAGGG - Intergenic
1094003512 12:25722538-25722560 AAGTGCTTCAAAAGAATGAATGG + Intergenic
1096826191 12:54279923-54279945 TATTGTGTGAAATGAATGGACGG - Intronic
1097425003 12:59433452-59433474 AAGGGTTGCAAATGAATGAATGG + Intergenic
1099475112 12:83098818-83098840 GAGAATTTCAAAGGAATAGAAGG - Intronic
1099768406 12:87020766-87020788 GGGTGTTCCAAATGTCTGGATGG - Intergenic
1099981866 12:89613400-89613422 TAGTGATTCAAATCATTGGAGGG + Intronic
1100511861 12:95283388-95283410 GACTGGATCAAATGAATGGTTGG + Intronic
1100812167 12:98350072-98350094 GTGTGTTTTGAATGAATGAATGG - Intergenic
1102777537 12:115533565-115533587 TGGTGCCTCAAATGAATGGAAGG + Intergenic
1103317318 12:120066721-120066743 GAGAGTTTCACATGAACTGAAGG - Intronic
1103823871 12:123720394-123720416 AACTGTTTCAAAAGAATGCAGGG + Intronic
1106565819 13:30883650-30883672 GAGGGTTTCAAATGTATCAAAGG + Intergenic
1106569691 13:30915790-30915812 GGGTGTTACAAGGGAATGGATGG - Intronic
1106625042 13:31411526-31411548 GAGATTTTCAAATTAAAGGAAGG + Intergenic
1107063608 13:36187984-36188006 GAGTGTTTCAAGAGACAGGAAGG - Intronic
1108142728 13:47442338-47442360 GTGTATATCAAATGTATGGATGG + Intergenic
1108957264 13:56175452-56175474 CAGTGTATCAAATGACTGGTAGG + Intergenic
1110488798 13:76078395-76078417 GAGTTTTTAAGATGAATGTATGG + Intergenic
1111987938 13:95083824-95083846 GAGTGTTTCAAAAGAACTAATGG - Intronic
1118415681 14:65533820-65533842 GAGTTTTTAACATGAAGGGATGG + Intronic
1119931737 14:78554097-78554119 GAGTGTTTCAAAGAAAATGAAGG - Intronic
1121979615 14:98443208-98443230 CTGTTATTCAAATGAATGGAAGG - Intergenic
1122316904 14:100831134-100831156 GTGAGGATCAAATGAATGGACGG - Intergenic
1123192860 14:106587603-106587625 GAGTATTACAAATAAATGAATGG - Intergenic
1124100878 15:26691449-26691471 GAGTGGATGTAATGAATGGAAGG - Intronic
1124985786 15:34611291-34611313 GCATGATTCAAATGAATGCATGG + Intergenic
1127619254 15:60717131-60717153 CAGTGTTAGAATTGAATGGAAGG + Intronic
1128992927 15:72275399-72275421 GAGAGATTCAAATGTTTGGAGGG - Intronic
1130178199 15:81597122-81597144 GAATGTTTCAAATGACTGAATGG - Intergenic
1133417606 16:5618707-5618729 GAGAATTTCAAAGGGATGGATGG - Intergenic
1133622885 16:7543125-7543147 GAGTGATTTAAATGCATGGCGGG - Intronic
1135293411 16:21259622-21259644 TAGATTTTCAAATGAATGGGGGG - Intronic
1136057710 16:27702782-27702804 GAGAGTCTTAAAGGAATGGATGG - Intronic
1137641360 16:50033159-50033181 AAGTATTTGAAATGAATGGAGGG + Intronic
1137821067 16:51446460-51446482 CAGTGTTTCATATGGATGCAGGG - Intergenic
1139219597 16:65167030-65167052 ATGTGTTACAAATGAATTGATGG - Intergenic
1143508493 17:7382814-7382836 GAGTGTTTCTAATGACTTGCAGG + Exonic
1146629722 17:34461053-34461075 AAGTGCTTCAAAGGAATGCATGG - Intergenic
1148585483 17:48775845-48775867 GAGTTTTTTAAAATAATGGATGG - Intronic
1148631408 17:49112531-49112553 GAGTGCTTCAATGGAATGAATGG + Intergenic
1149295561 17:55259299-55259321 GTGTGTTTCAAATCAGAGGATGG - Intergenic
1150252306 17:63713371-63713393 GAGTGTGTCACATGGAGGGAGGG - Intronic
1150972258 17:70042237-70042259 GAGTGATTCCAATAAATGGGGGG - Intergenic
1151763759 17:76121877-76121899 GACTGGTTCAGAGGAATGGAGGG - Intergenic
1152166023 17:78707079-78707101 GAGTGTTTAAAATGGAAAGAGGG + Intronic
1153203102 18:2666666-2666688 GAGTGTTTCAAATGAATGGAAGG + Intronic
1157147371 18:45177566-45177588 GAGTTATTCAAAAGAATGGGAGG - Intergenic
1158097469 18:53790389-53790411 TAGTATTTTAAATAAATGGAGGG + Intergenic
1160216415 18:76936266-76936288 ACATGTTTCAAATGAATGGATGG + Intronic
1160303776 18:77711851-77711873 GATTGCTTCAAATGCAGGGATGG - Intergenic
1162903088 19:13806953-13806975 GAGAGGTACATATGAATGGATGG + Intronic
1162916212 19:13875834-13875856 AAGTTTCTTAAATGAATGGATGG + Intronic
1164305243 19:24000411-24000433 TAGTGACTCATATGAATGGATGG - Intergenic
1166201958 19:41243443-41243465 GGGTGTGTGGAATGAATGGAAGG + Intronic
1167060998 19:47146275-47146297 AAGAGTTTCAAATGACAGGAAGG + Intronic
1167122941 19:47529713-47529735 GTGTTTTTCAGATGAATGGGAGG - Intronic
926023000 2:9513539-9513561 GAGTGTTTGAATTGAATTGGAGG + Intronic
926843060 2:17104692-17104714 CTGTGTTTCAAATGAATTGGAGG - Intergenic
926905203 2:17799030-17799052 GAACGTTTCAAATGAATTGGTGG - Intronic
927220592 2:20704910-20704932 GATTGGATCAAAAGAATGGAAGG - Intronic
928709698 2:33990224-33990246 GAGTGTTAGAAATCAATGGTAGG + Intergenic
930316627 2:49803715-49803737 GAGTGTACTAAATGAAAGGATGG + Intergenic
930559526 2:52943450-52943472 GAGTCCTTCAAATGATTGTATGG - Intergenic
930982373 2:57543027-57543049 GAGGGTTTCAACTGAATGCCTGG + Intergenic
931837396 2:66113363-66113385 GAGTGTTTCTTGTGAAAGGAAGG + Intergenic
932726211 2:74181981-74182003 GAGTTTTGCAAATGATAGGATGG - Intergenic
933560659 2:83882021-83882043 GACTGTTTCAAATGAATGTCTGG + Intergenic
935395631 2:102605717-102605739 AAGTTTTTCATATGAATGTATGG - Intergenic
936022845 2:109008126-109008148 GAGGTTTCCAAAGGAATGGAGGG - Intergenic
939012342 2:136861486-136861508 TAGTGTTTCAGAAGAATGCAAGG + Intronic
939218600 2:139272991-139273013 GGTTGATTCAAATGTATGGAGGG + Intergenic
939257859 2:139767816-139767838 GAGTGTTTTAAGTGATTGTAGGG + Intergenic
939261745 2:139819430-139819452 GCATGTTTCAGAAGAATGGAAGG - Intergenic
939897096 2:147805463-147805485 GAATGGTACCAATGAATGGAAGG - Intergenic
941462779 2:165791635-165791657 GAGTGTTGCAAATGGATGAAAGG + Intronic
945148403 2:206762825-206762847 CAGTGTTTCAAAAGCCTGGAAGG - Intronic
945201164 2:207283107-207283129 GATTGTTTCTGATGAGTGGATGG - Intergenic
945547176 2:211169959-211169981 TAGTGTTTAAAATGAAGGGCTGG + Intergenic
946893785 2:224302515-224302537 AAGTGTTTCTAATGATTGAAGGG - Intergenic
947241163 2:227995922-227995944 CTGTTTTTCAAATGATTGGAGGG - Intronic
1169789316 20:9392871-9392893 AAGTTTTGAAAATGAATGGATGG + Intronic
1170060786 20:12256608-12256630 GAGTGGCTAATATGAATGGATGG + Intergenic
1170099621 20:12684481-12684503 CAGTTTTACAAATGAATGAATGG - Intergenic
1170178494 20:13499967-13499989 GAGGACTTCAAATGAGTGGAGGG + Intronic
1174533488 20:51233172-51233194 TAATTTTTAAAATGAATGGAGGG + Intergenic
955474652 3:59323794-59323816 GATTGTTTCAGATAAATGGCAGG + Intergenic
955787898 3:62559144-62559166 AAGTGTGTCAAATGCAAGGAAGG - Intronic
955955236 3:64281965-64281987 GAGATTTTCAAAGGAAAGGAGGG - Intronic
957185944 3:76941205-76941227 GAGTAATTCAAGTGAAAGGAAGG - Intronic
959465447 3:106680764-106680786 GAGTCTTTTAAATTAATGCAGGG + Intergenic
960155425 3:114293191-114293213 GGGACTTTCAAATGAATGAAGGG + Intronic
960428017 3:117532848-117532870 GAGTGTTTCTAATGACTGTAGGG + Intergenic
964192596 3:154021731-154021753 GAGTATTTCAAATTTATGAAGGG + Intergenic
964279544 3:155048940-155048962 GAGTTTTTGAAATGGAGGGAAGG - Intronic
964394698 3:156233414-156233436 GAGTGTGTCCAATGAACTGAAGG + Intronic
964963861 3:162464744-162464766 GAATTTTTAACATGAATGGATGG - Intergenic
966143459 3:176783722-176783744 AAGTTTTGGAAATGAATGGAAGG - Intergenic
968795329 4:2700001-2700023 GAGTGGTTCATATGCCTGGATGG - Exonic
971152304 4:24046356-24046378 GAGGGTTGCAAATGACTGGATGG - Intergenic
972544720 4:40069440-40069462 GTGAGTTTAAAATGAAAGGAAGG - Intronic
974835534 4:67245193-67245215 GAGGGTTACAAATGGAAGGAAGG - Intergenic
975884611 4:78949961-78949983 GTGAGTTTCAAATGAAAAGATGG - Intergenic
976103167 4:81587281-81587303 TAGTGTTTCAAATGAACTCAGGG - Intronic
976735436 4:88304175-88304197 GAGCATTTCATATAAATGGAAGG - Intergenic
980144348 4:128962721-128962743 GAATGTTTCAAAGAAAAGGAAGG - Intronic
980601353 4:135029584-135029606 GAGTGTTTTAAATGAAAGAGGGG + Intergenic
980975381 4:139605645-139605667 GAGGGTTTCAGATGAAGGGGAGG + Intronic
982295018 4:153819178-153819200 GAGTTTTTAATATGAAGGGATGG - Intergenic
983035361 4:162858375-162858397 GATTGTTCCAAATGATCGGAAGG - Intergenic
984947020 4:184977201-184977223 TATTCTTTCAAATGAATGGCTGG - Intergenic
985974634 5:3407230-3407252 GAGTTTTTAACATGAATGGATGG + Intergenic
987600828 5:20068096-20068118 AAATGTTCCAAGTGAATGGAAGG - Intronic
988445053 5:31276483-31276505 GTGTGTTTCAAAGGACTTGAGGG + Intronic
991460529 5:66853723-66853745 TAGTTTTTTGAATGAATGGAAGG + Intronic
992234298 5:74693346-74693368 GAGTGACTCAAGTGACTGGATGG + Intronic
993539712 5:89133842-89133864 GAATGTTTCAAAGGAATTTATGG - Intergenic
994025042 5:95072437-95072459 GACTGTCTCACATGAATTGATGG + Intronic
994711206 5:103266816-103266838 GAATGATTCAAAGGAATGGTAGG + Intronic
996347807 5:122506252-122506274 GAATTTTTCAGGTGAATGGAAGG + Intergenic
996986169 5:129567461-129567483 GCATATTTCAAATGAATGGAAGG + Intronic
1001910880 5:175516618-175516640 AAGTGTTCATAATGAATGGAGGG - Exonic
1002383038 5:178844091-178844113 GAGTGTTTCAAAGGGAGGGAGGG - Intergenic
1003980353 6:11383797-11383819 GAGTGTTTATAATAAATTGATGG + Intergenic
1004764918 6:18715215-18715237 GAGAGTGTCAAATGAATGTCTGG - Intergenic
1005030245 6:21501559-21501581 GAGTTTTTAAAGTGAATGCAGGG + Intergenic
1008280446 6:49589663-49589685 GAGTCTTTCAAATAAATGGGTGG + Intergenic
1008866864 6:56222426-56222448 GAGCTTTTTAGATGAATGGATGG - Intronic
1009818089 6:68762966-68762988 GAATGTTTTAAATGAATGTATGG - Intronic
1010880420 6:81162110-81162132 GAGTTTTTAAAGTGAATGAAGGG - Intergenic
1010920617 6:81675563-81675585 CTGTGTTTCAAATGAATTGAGGG - Intronic
1016674464 6:146748192-146748214 CAGTGTGTTGAATGAATGGAAGG + Intronic
1016844354 6:148556386-148556408 GAGTTTTTCAAAGGAAAGAATGG - Intergenic
1017336808 6:153270751-153270773 GAGGGTTTCTAATGAAAGGTCGG + Intergenic
1017371094 6:153710083-153710105 GAGGGTTTCCCAGGAATGGAGGG - Intergenic
1019055312 6:169219121-169219143 GAGTGGATGAGATGAATGGATGG + Intronic
1021040631 7:15857626-15857648 GAGCATTTAAAAGGAATGGAAGG + Intergenic
1022691033 7:32654775-32654797 GAGTGTATAAAATGCATGGAAGG + Intergenic
1022918600 7:34988668-34988690 GAGTGTATAAAATGCATGGAAGG + Intronic
1023324266 7:39035674-39035696 ATGTGTTTCAACTTAATGGAAGG - Intronic
1025074588 7:55931970-55931992 GAGTGTTTGAAATGATTGGCTGG - Intronic
1026858043 7:73767980-73768002 GAGAGATTCAAATGACTGGATGG - Intergenic
1030670640 7:112332139-112332161 AAGTGTTTCAAAAGAAAGTAAGG + Intronic
1031423281 7:121574855-121574877 GAATGTTTCAAAAACATGGAGGG - Intergenic
1032697891 7:134353463-134353485 GTGGGTTTCAAATGAATGTATGG + Intergenic
1034062627 7:148107085-148107107 GTGTGTTTCACATGTTTGGAGGG - Intronic
1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG + Intronic
1035712062 8:1725514-1725536 CAGTCTTTCAAATGAATAGATGG - Intergenic
1036273197 8:7326220-7326242 GAGTTTTTAACATGAAGGGATGG - Intergenic
1036348151 8:7984132-7984154 GAGTTTTTAACATGAAGGGATGG + Intergenic
1036843436 8:12144607-12144629 GAGTTTTTAACATGAAGGGATGG + Intergenic
1036864811 8:12386923-12386945 GAGTTTTTAACATGAAGGGATGG + Intergenic
1037867273 8:22455529-22455551 GAGTGATTTTAATGAATGGCTGG + Intronic
1041354798 8:56989052-56989074 CAGTGTTAAAAATGAATGGAAGG - Intronic
1041423363 8:57693900-57693922 GAGTGAATCAGATAAATGGAGGG + Intergenic
1041624352 8:60008348-60008370 GAGTAGATAAAATGAATGGATGG + Intergenic
1046112189 8:109738545-109738567 TTGGGTTTCCAATGAATGGAGGG - Intergenic
1048652966 8:136501317-136501339 GAGTTTTTCATAGGAATGTAAGG - Intergenic
1048761315 8:137798686-137798708 AATTGTTTCAGATGAGTGGAGGG + Intergenic
1050817358 9:9832671-9832693 GAGTTTTTAAAATAAATGCAAGG + Intronic
1052284758 9:26772410-26772432 CATTTTTTAAAATGAATGGATGG + Intergenic
1057416939 9:94872193-94872215 GTGTGTTTAAAATGGATCGATGG + Intronic
1058925320 9:109657472-109657494 GTGTGTGTAAAATCAATGGAGGG + Intronic
1058964990 9:110028862-110028884 GAGTGTTGCAAAGGAAATGAAGG + Intronic
1185714073 X:2327251-2327273 GAGTGTTTCCAATGCATTCAGGG - Intronic
1188640319 X:32493249-32493271 TTGTGTTTCAAATGAATTGAGGG - Intronic
1190938469 X:55017870-55017892 CAGGGTTACAAATGACTGGAGGG - Intronic
1195555834 X:106221961-106221983 GATTAATTCAAATGAATGGTTGG + Intergenic
1195862655 X:109398244-109398266 GAGTGTCTCAAAGGAGTAGAGGG + Intronic
1196559552 X:117128900-117128922 GAGTTTTTAACATGAAGGGATGG - Intergenic
1196595804 X:117544214-117544236 GACTGTTTCAGATTAATGGGTGG - Intergenic
1199697086 X:150350381-150350403 GAGTGTTTTAAATTAATGGTTGG + Intergenic
1200428176 Y:3045633-3045655 GGGTGTGTCAAATGAATGTTTGG - Intergenic