ID: 1153210952 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:2763651-2763673 |
| Sequence | CAACCAAATCAATTCCAGTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 115 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 110} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1153210952_1153210954 | 2 | Left | 1153210952 | 18:2763651-2763673 | CCATACTGGAATTGATTTGGTTG | 0: 1 1: 0 2: 0 3: 4 4: 110 |
||
| Right | 1153210954 | 18:2763676-2763698 | ACTATAATAGCCACCATTAAAGG | 0: 1 1: 0 2: 0 3: 18 4: 123 |
||||
| 1153210952_1153210956 | 13 | Left | 1153210952 | 18:2763651-2763673 | CCATACTGGAATTGATTTGGTTG | 0: 1 1: 0 2: 0 3: 4 4: 110 |
||
| Right | 1153210956 | 18:2763687-2763709 | CACCATTAAAGGCTCTAATGAGG | 0: 1 1: 0 2: 0 3: 4 4: 80 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1153210952 | Original CRISPR | CAACCAAATCAATTCCAGTA TGG (reversed) | Exonic | ||