ID: 1153210952

View in Genome Browser
Species Human (GRCh38)
Location 18:2763651-2763673
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153210952_1153210954 2 Left 1153210952 18:2763651-2763673 CCATACTGGAATTGATTTGGTTG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1153210954 18:2763676-2763698 ACTATAATAGCCACCATTAAAGG 0: 1
1: 0
2: 0
3: 18
4: 123
1153210952_1153210956 13 Left 1153210952 18:2763651-2763673 CCATACTGGAATTGATTTGGTTG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1153210956 18:2763687-2763709 CACCATTAAAGGCTCTAATGAGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153210952 Original CRISPR CAACCAAATCAATTCCAGTA TGG (reversed) Exonic