ID: 1153210956

View in Genome Browser
Species Human (GRCh38)
Location 18:2763687-2763709
Sequence CACCATTAAAGGCTCTAATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153210952_1153210956 13 Left 1153210952 18:2763651-2763673 CCATACTGGAATTGATTTGGTTG 0: 1
1: 0
2: 0
3: 4
4: 110
Right 1153210956 18:2763687-2763709 CACCATTAAAGGCTCTAATGAGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153210956 Original CRISPR CACCATTAAAGGCTCTAATG AGG Exonic
901916685 1:12505694-12505716 CACAATTAAATGCTCAAAAGTGG + Intronic
907628922 1:56060578-56060600 CTCTGTTAAAGGCTTTAATGAGG + Intergenic
919540320 1:198837340-198837362 CACCACCAAAGCCTCTATTGTGG - Intergenic
921538981 1:216389031-216389053 AACCATTAAAGGCACTAAAGGGG + Intronic
1063580466 10:7301770-7301792 CACCAGGAAAGGCTGGAATGGGG - Intronic
1065337686 10:24671310-24671332 CAACACTAAAGGCTCTCTTGAGG - Intronic
1067092833 10:43278636-43278658 CACCATTCCTGGCTCTAAAGGGG - Intergenic
1068063723 10:52102245-52102267 CAACATTAAAGGCTTTCATATGG + Intronic
1080332526 11:31155727-31155749 CACCAGTAAATGCTCCCATGAGG + Intronic
1088687087 11:112293675-112293697 ACTCATTAAAGGCTCTTATGGGG - Intergenic
1091932008 12:4403667-4403689 CCTCATTAAAGGCTTTAAAGAGG - Intergenic
1094013184 12:25830535-25830557 CACCATAAAAGACTCTAAGGAGG + Intergenic
1097606841 12:61765646-61765668 TACCATTAAGTGCTATAATGAGG + Intronic
1098941947 12:76548297-76548319 CACTCTTAAAGGTTATAATGAGG - Intronic
1109693869 13:65928192-65928214 CAGCATTAAAAGCTCACATGAGG + Intergenic
1110303812 13:73961131-73961153 CATGATTAAAGGCTCAAAGGAGG - Intronic
1115456345 14:33608063-33608085 AACCATTAAATGCTCTGATATGG - Intronic
1117447554 14:55819107-55819129 CACGAAAGAAGGCTCTAATGGGG + Intergenic
1117518564 14:56527515-56527537 CACCATTAAAGTCTCTGCTTAGG - Intronic
1125249820 15:37687954-37687976 CAGCACTAAAAGCTCTACTGAGG + Intergenic
1125798574 15:42423805-42423827 CACCATTAAAAACTTTGATGAGG + Intronic
1126255392 15:46618968-46618990 AAACATTAGAGGCTCTAATGGGG + Intergenic
1127563325 15:60162316-60162338 TGCTATTAAGGGCTCTAATGAGG - Intergenic
1137054697 16:35738751-35738773 ATCCATTAAAGGTTGTAATGGGG + Intergenic
1139014648 16:62675595-62675617 CACCATAGCAGGCTCTAATCAGG + Intergenic
1139774624 16:69309216-69309238 CACCCTTAAATTCTCTAGTGAGG + Intronic
1150964404 17:69951357-69951379 CACCATTAAATGCTGAAGTGTGG - Intergenic
1153210956 18:2763687-2763709 CACCATTAAAGGCTCTAATGAGG + Exonic
1159043847 18:63349706-63349728 CACCATCAAGGTCTCTTATGGGG + Intronic
1160735397 19:660063-660085 CCCCATGAAAGGCTGTGATGAGG - Intronic
1164081221 19:21863000-21863022 AGCCATTAAAGGTTGTAATGGGG - Intergenic
1168424208 19:56225635-56225657 CAGCATTAAAGGATCCTATGAGG + Intronic
930480302 2:51940569-51940591 CACCATTGAATGTTCCAATGGGG - Intergenic
933398918 2:81766264-81766286 AACGATTAAAGGCTCTTATCTGG + Intergenic
933636120 2:84710670-84710692 CACCATCAAGGGCCATAATGAGG - Intronic
935600081 2:104913575-104913597 CACAATCAAAGGCTCTGCTGTGG + Intergenic
937631435 2:124106496-124106518 CTCCATTAAAGCCTGTAAAGGGG + Intronic
944468562 2:200028998-200029020 GACTATTAAAGACTCAAATGAGG + Intergenic
1170207714 20:13817044-13817066 CAGCATTAAGGGCTTTAATTGGG + Intronic
1172112850 20:32557550-32557572 CACCATTAACGGCTTGCATGAGG - Intronic
1175712598 20:61232959-61232981 GCCCATTAAAGGGTCTAATGGGG + Intergenic
950095125 3:10324567-10324589 CACCATTAGAGGCTCTTGTAGGG - Exonic
950108730 3:10404972-10404994 CTCCAGTAACTGCTCTAATGGGG - Intronic
950434430 3:12970260-12970282 CCCCAGGAGAGGCTCTAATGGGG + Intronic
955930080 3:64047599-64047621 CATCATTAAAGGGTATAATCAGG + Intergenic
957198367 3:77099730-77099752 CACCATAAAAGGGTCTGTTGGGG - Intronic
961004053 3:123392799-123392821 CACCATTAGAGTCTTTAGTGAGG - Intronic
961423944 3:126830333-126830355 CACCCTAAGAGGCTCTAAAGAGG - Intronic
967338233 3:188368256-188368278 CACCATCAAAGGCACAAATATGG + Intronic
972563997 4:40253619-40253641 GAGCATTAAAGGAGCTAATGTGG + Intergenic
972789278 4:42355359-42355381 CCCTATTAAAACCTCTAATGAGG - Intergenic
974337870 4:60574813-60574835 CACTTTTAAAGGCTCTTTTGAGG + Intergenic
976151082 4:82092508-82092530 CACCATGGAAGGCACTCATGTGG + Intergenic
977600624 4:98930340-98930362 GAACATTAAAGCCTCTATTGAGG - Intronic
980079953 4:128333748-128333770 CAACATTAGAGGCTCTGAAGTGG + Intergenic
984493411 4:180465699-180465721 CACCATTACAGAATATAATGTGG - Intergenic
992146478 5:73854975-73854997 TACCATTAAAGGCTCTGAGAAGG + Intronic
993250546 5:85515512-85515534 CAGCATTCAAGGCTCTAGTTTGG + Intergenic
994746902 5:103689659-103689681 CACCAATAAAGTCTCTACTTTGG - Intergenic
997309122 5:132865509-132865531 CACCATGAAAAGCTGAAATGAGG + Intronic
997662478 5:135600095-135600117 CAGCATGAAAAGCTGTAATGAGG - Intergenic
998545352 5:143023001-143023023 AACCACTGAGGGCTCTAATGAGG - Intronic
1003353768 6:5345663-5345685 CACAATTAAATGCTGTAAAGTGG + Intronic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1024893134 7:54226135-54226157 CTCCATTCAAGGCTATACTGTGG - Intergenic
1024900784 7:54316252-54316274 CTCCATTCAAGGCTATACTGTGG + Intergenic
1026824996 7:73576120-73576142 AAGCATTAAAGGCTCTATGGAGG + Intronic
1030118617 7:106083923-106083945 CACCCATGGAGGCTCTAATGAGG + Intergenic
1033849126 7:145473004-145473026 CTCCATGAAAGGCACTAAGGAGG + Intergenic
1033906323 7:146209000-146209022 CAGCATAAAAGGCTCAAAGGTGG - Intronic
1035956415 8:4085154-4085176 CACCATTACAGACTCTGCTGAGG + Intronic
1037832599 8:22198321-22198343 GGCCATCAAAGGCTCAAATGAGG - Intronic
1039885485 8:41651800-41651822 CAACATACAAGGCTCTATTGGGG + Intergenic
1040853968 8:51929855-51929877 AAGAATTAAAGACTCTAATGTGG - Intergenic
1042028003 8:64444386-64444408 CATGATTAAAGCCTCTAGTGTGG - Intergenic
1044256322 8:90067138-90067160 CACCATTTTAGTCTCTGATGAGG - Intronic
1045117686 8:99002059-99002081 GACCATTAAATGCTGAAATGTGG - Intergenic
1046678574 8:117140821-117140843 CACCAATAAAGGTAATAATGTGG + Intronic
1051101845 9:13531010-13531032 AACCATTGAAGGCTGAAATGTGG - Intergenic
1055536889 9:77257069-77257091 CACCATTAAAGGAGGAAATGAGG - Intronic
1057413029 9:94835171-94835193 CACAATGAAATGCACTAATGGGG - Intronic
1058095382 9:100854372-100854394 CGCCAATAAAGGTTTTAATGGGG + Intergenic
1187321361 X:18240787-18240809 CACCTTTAAATTCTCTAGTGAGG + Exonic
1198636548 X:138708254-138708276 CACCATTATAGTCTCCAATTTGG + Intronic
1200250497 X:154551310-154551332 CACCCTCAAAGGCTCTAAGAGGG + Intronic