ID: 1153212327

View in Genome Browser
Species Human (GRCh38)
Location 18:2780712-2780734
Sequence TGGTGTAAGTACTTGTATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 393}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153212324_1153212327 5 Left 1153212324 18:2780684-2780706 CCTGATTTGTAGCTTTTGCCAAT 0: 2
1: 28
2: 151
3: 336
4: 630
Right 1153212327 18:2780712-2780734 TGGTGTAAGTACTTGTATCATGG 0: 1
1: 0
2: 4
3: 39
4: 393
1153212323_1153212327 6 Left 1153212323 18:2780683-2780705 CCCTGATTTGTAGCTTTTGCCAA 0: 2
1: 29
2: 119
3: 262
4: 549
Right 1153212327 18:2780712-2780734 TGGTGTAAGTACTTGTATCATGG 0: 1
1: 0
2: 4
3: 39
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153212327 Original CRISPR TGGTGTAAGTACTTGTATCA TGG Intronic
901397673 1:8993263-8993285 TGGTGGAGGTAATTGAATCATGG - Intergenic
902135839 1:14304366-14304388 TGGGGTAAGTCCTTTTCTCAAGG - Intergenic
903117413 1:21189673-21189695 GCTTGTAATTACTTGTATCATGG + Intergenic
904369842 1:30041577-30041599 TGGTGTAAGTACTTCCACCACGG - Intergenic
904369843 1:30041580-30041602 TGGTGGAAGTACTTACACCACGG + Intergenic
904848799 1:33441317-33441339 TGGTGTAAGTACTCCTATCAAGG + Intergenic
905528351 1:38656386-38656408 GGGGGTGAGTACATGTATCAGGG + Intergenic
906112497 1:43333504-43333526 TGGTGTAAATACTTCCGTCATGG - Intergenic
908178827 1:61583862-61583884 TGGTGTAATTACTCCTACCATGG + Intergenic
908328363 1:63045408-63045430 TGGTGTAGATAATTGAATCATGG + Intergenic
909092576 1:71245060-71245082 TGATGAAAGTACTTATACCATGG - Intergenic
909092577 1:71245063-71245085 TGGTATAAGTACTTTCATCATGG + Intergenic
909160804 1:72147430-72147452 AGGTGTAGGTAGTTGAATCATGG - Intronic
910302700 1:85724974-85724996 TAGTGTAAATACTTGTACCATGG - Intergenic
910510165 1:87994562-87994584 TGGTGGAGGTAATTGAATCATGG + Intergenic
910820690 1:91342380-91342402 TGGTGTTATTACTTGCTTCAGGG - Intronic
911267338 1:95757821-95757843 TGGTGTAAATACTGTCATCATGG + Intergenic
911654985 1:100433846-100433868 TGGTAAAAGTATTTGTACCATGG - Intronic
911958977 1:104274160-104274182 TGGTGAAGATACTTGAATCATGG + Intergenic
913381117 1:118211063-118211085 TGGTGTAAATACTTCTACCATGG - Intergenic
915286245 1:154854455-154854477 TGGAGTAAGAAGTTGTATCTTGG + Intronic
915289444 1:154873228-154873250 TGGTGTAAATACTCTGATCATGG - Intergenic
916375696 1:164151106-164151128 TGGTGTAAATACTCTTACCATGG - Intergenic
916947414 1:169742793-169742815 TGGTGGGAGTAATTGAATCATGG - Intronic
917140274 1:171828305-171828327 AGGTGGAAGTAATTGTATCACGG - Intergenic
917716110 1:177739728-177739750 TGATGCTAGCACTTGTATCAGGG - Intergenic
918018890 1:180665280-180665302 AGGTGGAGGTACTTGGATCACGG - Intronic
918023431 1:180717774-180717796 TAGTGTAAATACTCCTATCATGG - Intronic
919525204 1:198638920-198638942 TGGTGTAATTACTTGAATTAAGG + Intronic
920289944 1:204914296-204914318 TGGTGGAGGTAATTGAATCATGG + Intronic
920609882 1:207425761-207425783 AGGTGGAAGTAATTGGATCATGG - Intergenic
921066402 1:211625618-211625640 TGGTGTAAATACTTCCACCACGG - Intergenic
922138288 1:222854470-222854492 AGGTGGAAGTAATTGGATCATGG - Intergenic
923233205 1:232007865-232007887 AGGTGTAGGTAATTGAATCATGG + Intronic
923258303 1:232241547-232241569 TGGTGTATGGACTTGTTTCTGGG - Intergenic
923811680 1:237325062-237325084 TTGTGTAAGTCATTGTATTAGGG + Intronic
924170596 1:241335796-241335818 TGGTTGGAGTATTTGTATCATGG - Intronic
1063549413 10:7015671-7015693 TGGTGTAAGTTCTCCCATCACGG + Intergenic
1063914433 10:10867160-10867182 TGGTGTAAATATTTCTACCATGG + Intergenic
1065065979 10:21965376-21965398 TGGTTTTAGTACTTGTAGTATGG - Intronic
1065441798 10:25760348-25760370 TGGTGTAAATACTTTCACCATGG + Intergenic
1065502318 10:26394434-26394456 AGGTGGAAGTAATTGAATCATGG - Intergenic
1068185571 10:53581230-53581252 TGGTGTAATTATTTCTATCATGG + Intergenic
1068202440 10:53799321-53799343 TGGTGGGTGTATTTGTATCATGG + Intergenic
1068424377 10:56839668-56839690 AGGTGGAAGTAATTGAATCATGG - Intergenic
1068815556 10:61306689-61306711 TGGTGTAAATATGTGTTTCATGG - Intergenic
1071177670 10:82945307-82945329 TGGTGAAAGCACTTGTACCCTGG - Intronic
1071244928 10:83752046-83752068 AGGTGGAAGTAATTGTATAATGG - Intergenic
1071468291 10:85960746-85960768 TGGTTTAATCACTTCTATCACGG + Intronic
1072880241 10:99219510-99219532 TGGTGTAGGTACTTGTGTTTTGG - Intronic
1072919453 10:99563699-99563721 AGGTGGAAGTAATTGAATCATGG - Intergenic
1073146182 10:101283645-101283667 GTGTGTATGCACTTGTATCATGG - Intergenic
1073374618 10:103022543-103022565 TGGTGTAAGTATTCCTACCATGG - Intronic
1073473834 10:103740169-103740191 TGGTTAAAGTACTTGCTTCAAGG - Intronic
1073913778 10:108378044-108378066 AGGTGAAAGTAATTGAATCATGG - Intergenic
1074759121 10:116652797-116652819 TGGTGTCATTACTTGTAAGATGG + Intergenic
1075533398 10:123249634-123249656 TGGTGTAAATACTTCCACCATGG + Intergenic
1075573214 10:123559945-123559967 TGGTGTAAATACTTCCACCAGGG - Intergenic
1075586479 10:123662077-123662099 TGCAGTGAGGACTTGTATCAAGG + Intergenic
1078553975 11:12303122-12303144 TGGTGGAGGTAATTGAATCATGG - Intronic
1079442065 11:20524778-20524800 TGGTGTAAATACTTTTATGTTGG + Intergenic
1080321015 11:31009590-31009612 TGGTGTAAGTCCTAGTGTGATGG + Intronic
1080672052 11:34389366-34389388 TGGTGTATGTACATATATGATGG - Intergenic
1080693756 11:34582957-34582979 TGGTGTAAATACTCCCATCATGG + Intergenic
1081245336 11:40759305-40759327 TGGTGTAAGAACATGTAACAGGG - Intronic
1085180827 11:74534702-74534724 TGGTGTAAATACTCCTACCATGG - Intronic
1085700495 11:78741368-78741390 TGGTGTAAATACTCTCATCATGG + Intronic
1085986443 11:81793570-81793592 AGGTGGAGGTAATTGTATCATGG - Intergenic
1086412630 11:86557835-86557857 TAGTGTAAATACTTGTACGATGG - Intronic
1086747647 11:90450206-90450228 TGGAGAAAGTAGTTGTATTAAGG - Intergenic
1087126147 11:94627493-94627515 TGGTGGGAGTAATTGAATCATGG - Intergenic
1087482591 11:98719979-98720001 AGGTGGAAGTAATTGAATCATGG - Intergenic
1089114642 11:116084776-116084798 TGGTGTAAATACTCCTACCATGG - Intergenic
1089324287 11:117646686-117646708 TGGTGTAATTACTTCTACCATGG - Intronic
1091677725 12:2503585-2503607 TGGTGTAAATACTTCCACCATGG + Intronic
1092026823 12:5247630-5247652 TTGTGTGAGTACCTGTATAATGG + Intergenic
1093006756 12:14059535-14059557 AGGTGGAAGTAATTGAATCATGG - Intergenic
1093633098 12:21433351-21433373 TGGTGTAAATACTCCTATTACGG + Intergenic
1094050511 12:26215561-26215583 TGGTGTGACTACTTCTACCATGG - Intronic
1095314364 12:40741745-40741767 TAGGATAAATACTTGTATCAAGG - Intronic
1097630142 12:62050817-62050839 TGGTGTAAATACTCCTACCATGG - Intronic
1098245808 12:68516607-68516629 TGGTGTACGTGTTTTTATCATGG - Intergenic
1098357815 12:69627618-69627640 TGGTGGAAGCGATTGTATCATGG + Intergenic
1099089028 12:78280914-78280936 TGGGGTTAGAGCTTGTATCATGG - Intergenic
1099095101 12:78365601-78365623 TGGTGAAAGTGTTTGGATCATGG + Intergenic
1100099650 12:91088061-91088083 AGGTGGAAGTAATTGAATCATGG - Intergenic
1101147574 12:101855554-101855576 TGGTGTAAGCACTTGTAGGGTGG + Intergenic
1101403236 12:104406359-104406381 TGGTGTAAATACTCCCATCATGG + Intergenic
1104588488 12:130066163-130066185 TGGTGTAAATACTTGCAGCATGG - Intergenic
1104659860 12:130603390-130603412 AGGTGTAAGCACCTGCATCATGG + Intronic
1105522517 13:21143641-21143663 TGTAGTAAGTCCTTTTATCAGGG + Intronic
1106089257 13:26573763-26573785 TGGTCTGAGTACTGGTTTCATGG - Intronic
1107330015 13:39289333-39289355 TGGTGGAGGTAATTGAATCATGG - Intergenic
1108276898 13:48820034-48820056 TGGTGTAAGTTTTTGTCTCCAGG - Intergenic
1111189674 13:84791069-84791091 AGGTGTAGGTAATTGAATCATGG + Intergenic
1111715370 13:91873439-91873461 TGGTGGAAGTGATTGAATCATGG + Intronic
1111718868 13:91916853-91916875 AGGTGGAAGTAATTGAATCAAGG - Intronic
1111754177 13:92371751-92371773 AAGTGTAAGTAATTGAATCATGG - Intronic
1112161964 13:96877545-96877567 TGGTGTAAGTCTTTGTAAAAGGG + Intergenic
1112581081 13:100676489-100676511 TGGTGTAAATACTTCGACCATGG - Intergenic
1115697905 14:35920408-35920430 TGGTGTGAGCAGTTGAATCATGG - Intronic
1116923034 14:50601497-50601519 TGGTGTAAATACTTTTACCATGG + Intronic
1117320499 14:54618292-54618314 TGGTGTAAATACTCCTAACATGG - Intronic
1117390175 14:55255257-55255279 TGGTGTAAATACTCCCATCATGG - Intergenic
1117441912 14:55767879-55767901 AGGTGAAGGTACTTGAATCATGG + Intergenic
1117931255 14:60842838-60842860 TGTTCTGAGTACTTGTATTAAGG - Intronic
1118429989 14:65708138-65708160 TGGTGGATGTAATTGAATCATGG + Intronic
1118663319 14:68039010-68039032 TGGTGTTAATACTTCTACCATGG - Intronic
1118686170 14:68293348-68293370 TGGTGAAAGTATTTATACCATGG + Intronic
1119273564 14:73331659-73331681 AGGTGGAAGTAATTGGATCATGG + Intronic
1119651912 14:76389987-76390009 TGGTGTAAATACTCCCATCATGG - Intronic
1119839342 14:77779873-77779895 AGGTGGAAGTATTTGAATCATGG - Intergenic
1121858694 14:97295421-97295443 TGGTGTAAAAACGTGTAACACGG + Intergenic
1122052474 14:99069442-99069464 TGGTGTAAATACTTCCACCATGG - Intergenic
1124585190 15:30998590-30998612 TGGTGTAAGTACTCCTACCATGG - Intergenic
1124835251 15:33190727-33190749 GGGTGTGAGTACTAGTATCCTGG + Intronic
1126252206 15:46581200-46581222 TGGTGTATGTACTCCTATCATGG - Intergenic
1126744298 15:51810491-51810513 TGGTGTAAATATTTCTACCATGG - Exonic
1126856870 15:52847451-52847473 TGGTGAAGGTAATTGAATCATGG - Intergenic
1127134679 15:55907349-55907371 TGATTTAATTACTTTTATCAAGG - Intronic
1127572069 15:60253331-60253353 AGGTGTAGGTAATTGAATCATGG - Intergenic
1127575620 15:60288819-60288841 TGGTGTAAATACTCCCATCATGG + Intergenic
1127714281 15:61633458-61633480 AGGTGGAAGTAATTGGATCATGG + Intergenic
1128880853 15:71241662-71241684 TGGTGTAAATACTTCCATCATGG - Intronic
1129760343 15:78125536-78125558 AGGTGTAAGTAATTGTGACAGGG - Intronic
1130185425 15:81677028-81677050 TGGTGTAAATACTTCCACCATGG + Intergenic
1130440529 15:83948302-83948324 TGGTGTAAATACTCCCATCATGG - Intronic
1130754702 15:86750684-86750706 TTGTGTAGGTAATTGTGTCATGG + Intronic
1130970727 15:88729902-88729924 TGGTGTAAATACTCCCATCATGG - Intergenic
1131012281 15:89028221-89028243 AGGTGGAAGTAATTGAATCATGG + Intergenic
1131607920 15:93928467-93928489 TGGTAGAAGGACTTGTTTCATGG - Intergenic
1131861868 15:96662213-96662235 AGGTGTAGGTAATTGGATCATGG + Intergenic
1132414207 15:101609191-101609213 TGGTGTAAATACTCCTATCATGG + Intergenic
1134166774 16:11936532-11936554 TGGTATTAGTACTTTTATCTTGG + Intronic
1134493932 16:14717180-14717202 TGGTATTAGTACTTTTATCTTGG - Intronic
1134499312 16:14756304-14756326 TGGTATTAGTACTTTTATCTTGG - Intronic
1134525861 16:14942924-14942946 TGGTATTAGTACTTTTATCTTGG - Intronic
1134546545 16:15113437-15113459 TGGTATTAGTACTTTTATCTTGG + Intronic
1134547030 16:15117920-15117942 TGGTATTAGTACTTTTATCTTGG + Intronic
1134581257 16:15372709-15372731 TGGTATTAGTACTTTTATCTTGG + Intronic
1135212483 16:20535321-20535343 TGGTGTAAGTCCTGGTCTGAGGG - Intergenic
1135312165 16:21413949-21413971 TGGTATTAGTACTTTTATCTTGG + Intronic
1135365113 16:21846405-21846427 TGGTATTAGTACTTTTATCTTGG + Intronic
1135446726 16:22524934-22524956 TGGTATTAGTACTTTTATCTTGG - Intronic
1136151336 16:28351872-28351894 TGGTATTAGTACTTTTATCTTGG + Intronic
1136167568 16:28465713-28465735 TGGTATTAGTACTTTTATCTTGG + Intronic
1136195408 16:28649305-28649327 TGGTATTAGTACTTTTATCTTGG - Intronic
1136211746 16:28763421-28763443 TGGTATTAGTACTTTTATCTTGG - Intronic
1136256467 16:29043369-29043391 TGGTATTAGTACTTTTATCTTGG - Intronic
1136308868 16:29392940-29392962 TGGTATTAGTACTTTTATCTTGG + Intronic
1136322285 16:29494471-29494493 TGGTATTAGTACTTTTATCTTGG + Intronic
1136436964 16:30234443-30234465 TGGTATTAGTACTTTTATCTTGG + Intronic
1136685423 16:31991365-31991387 TGGTGTAAATACTCCTACCATGG + Intergenic
1136786037 16:32934895-32934917 TGGTGTAAATACTCCTACCATGG + Intergenic
1137687710 16:50398307-50398329 TGGTCGGAGTATTTGTATCATGG + Intergenic
1138226216 16:55297543-55297565 TGGTGTGAGTAATTGAATCATGG + Intergenic
1138245144 16:55462007-55462029 TGGAATAAGTACCTCTATCATGG - Intronic
1139856573 16:69985371-69985393 TGGTATTAGTACTTTTATCTTGG + Intergenic
1139914872 16:70421695-70421717 TGGAGTAAGACCTTGTCTCAAGG - Intronic
1140270364 16:73459883-73459905 AGGTGGAAGTAATTGAATCACGG - Intergenic
1140366158 16:74382686-74382708 TGGTATTAGTACTTTTATCTTGG - Intronic
1140369244 16:74404370-74404392 AGGTGGAGGTACTTGCATCATGG - Intergenic
1140570217 16:76095553-76095575 TGGTATAAGTGCATGTCTCAAGG + Intergenic
1142047232 16:87933251-87933273 TGGTGTAAATACTTTCACCATGG + Intronic
1203088270 16_KI270728v1_random:1196553-1196575 TGGTGTAAATACTCCTACCATGG + Intergenic
1148609058 17:48951853-48951875 TGGTGTAAATACTCTGATCATGG + Intergenic
1149117085 17:53110480-53110502 TTATGTAAGTACTCGTGTCATGG - Intergenic
1149796351 17:59524137-59524159 TGGTGTAAGTACTCCTACCATGG - Intergenic
1149934645 17:60792585-60792607 TGGTGAAGGTACTTGGATCATGG + Intronic
1149950810 17:60983609-60983631 TGGTGTTAGTAACAGTATCAAGG - Intronic
1150030128 17:61724955-61724977 TAGTGTAAACACTTCTATCAGGG + Intronic
1150843876 17:68635210-68635232 AGGTGGAAGTAATTGAATCATGG + Intergenic
1151204063 17:72492149-72492171 TGATGTAAGTACCTGTTACATGG - Intergenic
1153212327 18:2780712-2780734 TGGTGTAAGTACTTGTATCATGG + Intronic
1153324359 18:3803087-3803109 TGGTGTAAATATTTCCATCACGG + Intronic
1154118047 18:11628636-11628658 TGGTATTAGTACTTTTATCTTGG + Intergenic
1154366677 18:13716633-13716655 TGGTGGGAGTAATTGGATCAGGG + Intronic
1155968192 18:32055625-32055647 AGGTGTAGGTAATTGAATCATGG - Intronic
1156217372 18:35013452-35013474 TAATGTAAGTAATTATATCAGGG + Intronic
1156655728 18:39283829-39283851 AGGTGTAGGTAATTGGATCATGG + Intergenic
1157167091 18:45367692-45367714 TGGTGTAAATACTTGAATCATGG - Intronic
1157471812 18:47994653-47994675 TGGTGTAAATACTCCTATCACGG + Intergenic
1157698607 18:49745047-49745069 GGGTGTAAGTACCTGAATGAAGG + Intergenic
1157922693 18:51730042-51730064 TGGTGTAAATACTCTCATCATGG - Intergenic
1158845934 18:61443032-61443054 AGTTGTAAGTACTTTTATGATGG + Intronic
1159419754 18:68202201-68202223 TGGTGTAAGCACTAGGATGAAGG + Intergenic
1162879608 19:13648523-13648545 TGGTGTAAATACTTCTTCCATGG - Intergenic
1163340163 19:16700796-16700818 TGGTGTGGGTACTTGAAGCATGG - Intergenic
1166227413 19:41405215-41405237 TGGTATAAGTACTTATCTCAGGG - Intronic
1167374128 19:49102176-49102198 TGGTATAAGGGTTTGTATCATGG + Intronic
926069600 2:9875668-9875690 TGGGGAAAGTAATTGAATCATGG - Intronic
926459527 2:13111490-13111512 TGGTGGGAGTAATTGAATCATGG + Intergenic
926798033 2:16634839-16634861 TGGTGTAAATACTTCCACCATGG - Intronic
928260780 2:29764410-29764432 TGGTGTAAATACTCCTACCATGG - Intronic
928494628 2:31819524-31819546 TAGTGAAAGTAATTGGATCATGG - Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929141616 2:38671537-38671559 TGGTGGAGGTAATTGGATCAGGG - Intronic
929213311 2:39383405-39383427 TGGTGGAGGTAATTGAATCATGG - Intronic
929912497 2:46102115-46102137 TGGTATAAGTACTACCATCATGG - Intronic
930582648 2:53230549-53230571 AGGTGGAAGTAATTGAATCATGG + Intergenic
930632093 2:53764705-53764727 TGGTGTAAATACTCCTACCATGG + Intronic
931162115 2:59703801-59703823 TGGTGGAGGTACTTGAATTATGG - Intergenic
931162367 2:59705752-59705774 AGGTGGAAGTAATTGAATCATGG - Intergenic
932690877 2:73912590-73912612 TTGTGTAAGGACCTGAATCATGG - Intronic
934087850 2:88525243-88525265 TGGTGTAAATGCTCCTATCATGG - Intronic
937030524 2:118735539-118735561 AGGTGGAAGTAATTGAATCATGG - Intergenic
939507646 2:143068978-143069000 TGGTATAAATACTTCTACCATGG - Intergenic
939660485 2:144882723-144882745 TGGTGTAAATACTCCTGTCATGG + Intergenic
939683773 2:145171811-145171833 TGGTGTAAGTACTGGTGTTGGGG + Intergenic
939685387 2:145192424-145192446 TGCTGTAAGTAGTTGTAGCGTGG + Intergenic
940757018 2:157694751-157694773 TGGTGTAAATACTTCCACCATGG + Intergenic
940858658 2:158750225-158750247 TGATGAAAGTACCTGTCTCAAGG - Intergenic
941083787 2:161092732-161092754 TGATGGGAGTATTTGTATCATGG - Intergenic
941207768 2:162595326-162595348 AGGTGGAGGTACTTGTATTATGG - Intronic
943248262 2:185483888-185483910 TGGTGGGAGTGATTGTATCATGG + Intergenic
943261083 2:185664626-185664648 GGGTGTAAGTACTTGCAGCCAGG - Intergenic
943663268 2:190581898-190581920 TGGTGTAAATACTCCCATCATGG - Intergenic
944136700 2:196407352-196407374 TGGTGGAAGTATTTATACCATGG - Intronic
944136850 2:196409055-196409077 TGGTATAAATACTTCTACCATGG - Intronic
945087230 2:206144255-206144277 TGGAATAATTACTTGTATCTAGG - Intronic
946483071 2:220075108-220075130 TGGTGGAAGTAATTGAATCATGG + Intergenic
946600976 2:221359822-221359844 TGGTGTAAATACTCCTACCATGG + Intergenic
947032380 2:225811646-225811668 AGGTGGAAGTAATTGAATCATGG - Intergenic
947442093 2:230132311-230132333 AGGTGTAGATAATTGTATCATGG + Intergenic
947889319 2:233603087-233603109 TGGTGGAGGTAATTGAATCATGG - Intergenic
948292698 2:236838040-236838062 AGGTGGAGGTAATTGTATCATGG + Intergenic
948649756 2:239434366-239434388 TGGTGTAAATACTCCTACCAAGG - Intergenic
1169592651 20:7162635-7162657 AGGTGTAGGTAATTGAATCATGG + Intergenic
1170815264 20:19708621-19708643 TGGTGTAAATACTGCCATCATGG - Intronic
1170835540 20:19881256-19881278 TGGTGTAAATACTCCCATCATGG - Intergenic
1172742137 20:37177306-37177328 TGGTGTAAATACTCCCATCATGG + Intronic
1174006808 20:47417389-47417411 TGGTGTAAATACTTCCACCATGG - Intergenic
1174718455 20:52785350-52785372 TGCTGTAAGTAATCATATCAAGG + Intergenic
1177719286 21:24883647-24883669 AGGTGGAGGTACTTGGATCATGG + Intergenic
1177780636 21:25619282-25619304 TGGTGTAAGTCCCTGTCTGAGGG + Intergenic
1178400810 21:32283269-32283291 TGGTGGGAGTAATTGGATCATGG - Intergenic
1178632078 21:34270556-34270578 TGGTTTAAATACTCCTATCATGG - Intergenic
1178773947 21:35531107-35531129 TGGTGGGAGTACTTACATCATGG - Intronic
1181790212 22:25259527-25259549 TGGTGTAAATACTACCATCATGG + Intergenic
1181826024 22:25516538-25516560 TGGTGTAAATACTACCATCATGG + Intergenic
1181995611 22:26879217-26879239 TTGTCTAAGTATTTGTATCCAGG - Intergenic
1182839226 22:33372621-33372643 TGGTGGAAATAATTGAATCATGG - Intronic
1184626220 22:45732738-45732760 TGGTGGAAGTAGTTGTGCCATGG + Intronic
949467581 3:4359740-4359762 TGGTGGGAGTAATTGAATCATGG - Intronic
950778362 3:15369853-15369875 TGGTGTAAATACTCCCATCACGG - Intergenic
951245458 3:20336200-20336222 TGGAGTAAATACTCCTATCATGG + Intergenic
952500697 3:33959170-33959192 TGGTGTAAGTACTCCTACCATGG + Intergenic
952505371 3:34002459-34002481 AGGTGTAGGTAATTGGATCATGG + Intergenic
954600983 3:51869083-51869105 AAGTGTAGGTAATTGTATCATGG + Intergenic
955056684 3:55461410-55461432 AGGTGTAGGTAATTGGATCATGG - Intergenic
955091205 3:55752383-55752405 TCGTGTAAATACTTCTACCATGG - Intronic
955173617 3:56589759-56589781 GGATGTAAGTCCTTTTATCAAGG - Intronic
955776841 3:62442590-62442612 TGGTGTAAATACTCCCATCAAGG + Intronic
955989128 3:64606325-64606347 TGGTGTAAATACTCTCATCATGG + Intronic
956727596 3:72169205-72169227 TGGTGTAAATACTCCTACCATGG - Intergenic
958072583 3:88633555-88633577 TGGTGGAAGTGATTGGATCATGG - Intergenic
958698461 3:97556585-97556607 TGGTGGAGGTAATTGAATCATGG - Intronic
958737998 3:98031993-98032015 TGGTGTAAATACTTCCACCATGG + Intronic
960009598 3:112819164-112819186 TGGTGTAGGTGATTGGATCATGG - Intronic
960529690 3:118749227-118749249 TGGAGTAATAACTTGGATCAGGG - Intergenic
961342799 3:126240073-126240095 AGGTGAAAATACTTGAATCATGG - Intergenic
963333700 3:143946850-143946872 TAATGTAAATACTTTTATCATGG + Intergenic
963497140 3:146079721-146079743 TGGTGTAAATACTTCTACCATGG - Intronic
963538813 3:146561579-146561601 AGGTGGAGGTAATTGTATCATGG - Intergenic
964257941 3:154798966-154798988 TGCTGTAAATACTTCTATAATGG + Intergenic
964870045 3:161303537-161303559 TGGTGGAGGTAATTGAATCATGG + Intergenic
964966056 3:162495322-162495344 AGGTGGAGGTAATTGTATCATGG - Intergenic
967296459 3:187969949-187969971 TGGTATAAATACTTGCACCATGG + Intergenic
967438848 3:189482972-189482994 TGGTATAAGTCATTGTATCTTGG + Intergenic
967839346 3:193992313-193992335 TGGTGTAAATACTTTTATCATGG - Intergenic
968981040 4:3849554-3849576 TGGTGTTAGTACTGGGAGCATGG - Intergenic
969953671 4:10866109-10866131 TGGAGTAAGTGCTAGTCTCAAGG + Intergenic
970780740 4:19734606-19734628 AGGTGGAAGTAATTGAATCATGG - Intergenic
971591221 4:28472104-28472126 AGGTGGAAGTAATTGGATCATGG + Intergenic
971593912 4:28502989-28503011 TGGTGTAAGTATCCATATCATGG + Intergenic
971710446 4:30104962-30104984 AGGTGTAGGTAATTGGATCATGG - Intergenic
971721919 4:30255916-30255938 TGGTGCTAGTACTTGTGTCTGGG - Intergenic
971832364 4:31712504-31712526 AGGTGGAGGTAATTGTATCATGG + Intergenic
972363008 4:38346129-38346151 AGGTGGAGGTAATTGTATCATGG + Intergenic
972410543 4:38789233-38789255 TGGTGTAAATACTCCTACCATGG - Intergenic
972464500 4:39341774-39341796 TTGTGTAAGTAATTGTTTCATGG - Intronic
972920293 4:43931228-43931250 AGGTGGAAGTAATTGGATCATGG + Intergenic
973677473 4:53279921-53279943 AGGTGGAGGTAATTGTATCATGG - Intronic
974784816 4:66606104-66606126 TGGCGTAAATACTTCTACCATGG + Intergenic
975183298 4:71371816-71371838 TGGTGCAGGTACTTGAAACAAGG + Intronic
975318281 4:72980126-72980148 AGGTGGAAGTAATTGGATCATGG + Intergenic
976356616 4:84126306-84126328 AGGTGTAGGTAATTGAATCACGG - Intergenic
978129590 4:105179095-105179117 AGGTGGAAGTAATTGGATCATGG - Intronic
978665895 4:111182150-111182172 AGGTGTAGGTAATTGGATCATGG - Intergenic
979236162 4:118402664-118402686 TGGTGGAGGTAATTGAATCATGG - Intergenic
980613721 4:135192144-135192166 TGGCGGAAGTAATTATATCATGG + Intergenic
981194522 4:141903101-141903123 TGGTGGAAGTATTTGGGTCATGG - Intergenic
981333713 4:143542566-143542588 TTCTTTAAATACTTGTATCATGG - Intronic
981897462 4:149819718-149819740 TAGTGTTAGTCCTTGTGTCAGGG - Intergenic
982509642 4:156265379-156265401 TGATGTAGGTAATTGAATCATGG + Intergenic
982567014 4:156998154-156998176 TGGTGGAAGTGTTTGTATCATGG - Intergenic
982616906 4:157649932-157649954 TGTTGTAAATTCTTATATCATGG - Intergenic
982775254 4:159434975-159434997 AGGTGTAGGTAATTGAATCATGG + Intergenic
983102259 4:163639288-163639310 TCATGTAATTATTTGTATCAGGG - Intronic
983550000 4:169008501-169008523 TGGTGTAAGCATATTTATCAAGG - Intronic
985394533 4:189528027-189528049 TGGTGAAGGTAATTGAATCATGG - Intergenic
986275503 5:6271741-6271763 AGGTGGAAGTAATTGAATCATGG + Intergenic
986448347 5:7842828-7842850 TGGTGTAAATACTTCGGTCATGG + Intronic
986987477 5:13515460-13515482 AGGTGAAAGTAATTGAATCATGG + Intergenic
987033190 5:13994549-13994571 GAGTGTAAGTAGTTGTGTCAGGG - Intergenic
987303922 5:16620282-16620304 AGGTGTAGGTAATTGAATCATGG + Intergenic
987415456 5:17656773-17656795 TTTTGTAAGTACTGATATCATGG - Intergenic
988619473 5:32808416-32808438 TGATGTAAATACTTGTACCGTGG - Intergenic
988676215 5:33435621-33435643 AGGTGTAGGTAATTGCATCACGG + Intergenic
989141178 5:38203080-38203102 TGGTGTCAGTTCTTGTCTCAGGG + Intergenic
989152028 5:38309275-38309297 TGGTGTAAATACTCATACCATGG - Intronic
989179967 5:38566910-38566932 TGGTGTAAATACTTTTACCATGG + Intronic
991440619 5:66644515-66644537 AGGTGTAGGTACCTGTCTCAGGG - Intronic
991769042 5:70023114-70023136 TGGTGGAGGTAATTGAATCATGG - Intergenic
991848337 5:70898532-70898554 TGGTGGAGGTAATTGAATCATGG - Intergenic
992392944 5:76346076-76346098 TGGTGTAATTACTTCCACCATGG + Intronic
992490188 5:77235042-77235064 TGGTCTAAGTACAATTATCATGG + Intronic
992946138 5:81812029-81812051 TGGTGGAGGTATTTGTATCCTGG - Intergenic
993283334 5:85957656-85957678 AGGTGAAAGTAATTGAATCATGG + Intergenic
994490793 5:100440855-100440877 TGGTGGGAGTGCTTGTATCATGG + Intergenic
994952662 5:106484340-106484362 AGGTGGAAGTAATTGGATCATGG + Intergenic
994968328 5:106702689-106702711 AGGTGGAAGTAATTGAATCATGG + Intergenic
995451910 5:112311362-112311384 TGGTGTAAGTACATCAAGCAAGG + Intronic
996045403 5:118867314-118867336 TGGAGTAAGTAATTCTATCTTGG - Intronic
997335405 5:133105233-133105255 TGGTGTAAAGATTTGTATCCTGG + Exonic
997595775 5:135106498-135106520 TGGAGTAAATAGTTGCATCAAGG + Intronic
997890142 5:137668811-137668833 TGGTGTAAATATTTTCATCAAGG - Intronic
998687689 5:144548492-144548514 AGGTGGAAGTAATTGAATCATGG + Intergenic
999082545 5:148857730-148857752 TGGTGTAACTACTGGGGTCATGG + Intergenic
1000901534 5:166917251-166917273 TGGTGTAAATATTTGCAACATGG - Intergenic
1001358555 5:171057862-171057884 AGGTGTAGGTAATTGGATCATGG - Intronic
1003856501 6:10281339-10281361 AGGTGGAGGTACTTGAATCATGG - Intergenic
1005971243 6:30763590-30763612 TGGTGTAAATACTTCCATCAAGG - Intergenic
1006130886 6:31868904-31868926 TGGAGTAAGTCCTGGTATCCAGG + Intronic
1008224060 6:48890366-48890388 AGGTGAAAGTAATTGAATCATGG - Intergenic
1008308240 6:49932641-49932663 TGGTGTAAATACTCCTAACACGG + Intergenic
1009327668 6:62373911-62373933 AGGTGGAAGTAATTGAATCATGG - Intergenic
1009550935 6:65090192-65090214 AGGTGAAAGTAATTGGATCATGG + Intronic
1011500351 6:87981645-87981667 TGGTGTAAGTACCAGTCTGAGGG + Intergenic
1011667571 6:89649509-89649531 TGGTATAAGTAATTCTATTAAGG + Intronic
1011670899 6:89682119-89682141 TGGTGTAAATACTCCTATTATGG - Intronic
1012507485 6:99964628-99964650 GGGTGGAAGTAATTGGATCATGG - Intronic
1015815802 6:137209450-137209472 TGGGGGAAGTAATTGAATCACGG + Intronic
1016683105 6:146853073-146853095 TGGTGGGAGTAATTGGATCATGG - Intergenic
1019362625 7:613040-613062 TGGTGTAGATACATGTAACAAGG + Intronic
1020539839 7:9447358-9447380 TGGTGTAAATATTTTCATCATGG + Intergenic
1020674542 7:11165435-11165457 TGATGTAAGTACCTTTATAATGG - Intronic
1020680966 7:11235695-11235717 AGGTGGAAGTAATTGAATCAAGG + Intergenic
1020854749 7:13404863-13404885 TGGTGTAAGGACTGTGATCATGG + Intergenic
1020864203 7:13536179-13536201 TGGTGTACATACTTGTACCATGG + Intergenic
1021085577 7:16418726-16418748 AGGTGGAAGTAATTGAATCATGG - Intronic
1021168005 7:17363640-17363662 TGGTTTAACTACATGCATCAAGG + Intergenic
1021890456 7:25181067-25181089 AGGTGGAAGTAATTGGATCATGG + Intergenic
1022032079 7:26501247-26501269 AGGTGGAAGTAATTGAATCATGG + Intergenic
1022985308 7:35648432-35648454 TGGTGTAAATACTCCCATCATGG - Intronic
1023386692 7:39664999-39665021 TAGTTTTAGTGCTTGTATCACGG - Intronic
1023576440 7:41632995-41633017 TGGTGGAAGTACTTACACCATGG - Intergenic
1023576442 7:41632998-41633020 TGGTGTAAGTACTTCCACCAGGG + Intergenic
1023947464 7:44814607-44814629 TGCTGTAACTGCTTGTAGCAAGG + Intronic
1024683038 7:51713993-51714015 TGGTGTAAGTTCTAGTCTAAAGG - Intergenic
1026407293 7:70079724-70079746 TGGTGTAAATACTTCCACCATGG - Intronic
1028153630 7:87405058-87405080 TGCTGTAAATACTTGTATACAGG - Intronic
1029096682 7:98090566-98090588 TGGTATAAATACTCATATCATGG + Intergenic
1029251465 7:99239737-99239759 TGGTATAAATACTTCCATCACGG - Intergenic
1030082919 7:105792724-105792746 TGGTGTAAATACTTCCACCATGG - Intronic
1030774741 7:113520144-113520166 AGGTGGAAGTAATTGAATCATGG + Intergenic
1031755602 7:125638042-125638064 AGGTGTAGGTAATTGAATCATGG - Intergenic
1031793483 7:126140056-126140078 TGGTGGAGGTAATTGAATCATGG - Intergenic
1031805550 7:126302644-126302666 GGGTGTAAGTACATTTAACAGGG - Intergenic
1031994550 7:128220985-128221007 TGGTGCAAGTATTTATACCATGG + Intergenic
1032493385 7:132342019-132342041 TGGTCTAAGCACTGGCATCAAGG + Intronic
1032507725 7:132448384-132448406 TGGTGTAAATACTTCTACCCTGG - Intronic
1032594464 7:133225561-133225583 TGGTGTAAATACTTGTACCATGG + Intergenic
1032746139 7:134788352-134788374 TGGTGTAATTACTTCCATCATGG - Intronic
1032904800 7:136351625-136351647 TGGTATAAATACTTCTACCATGG - Intergenic
1034204155 7:149301154-149301176 TGGTGGGAGTAATTGAATCATGG + Intergenic
1035149004 7:156850865-156850887 TGGTGGAAGTGTTTGGATCATGG + Intronic
1036090966 8:5664808-5664830 AGGTGGAAGTAATTGAATCATGG + Intergenic
1036192790 8:6686255-6686277 TGGTGTAAATACTCATACCATGG - Intergenic
1039644866 8:39270065-39270087 AGGTGGAAGTAATTGAATCACGG - Intronic
1040453435 8:47572361-47572383 AGGTGTAAAAACTTGTATGAGGG + Intronic
1041310791 8:56514402-56514424 TGGTGTAAATAGTTTCATCATGG + Intergenic
1041596796 8:59664481-59664503 TGGTATTAGTATTGGTATCATGG + Intergenic
1041844781 8:62315955-62315977 TGGTGGGAGTAATTGAATCATGG + Intronic
1043068509 8:75607786-75607808 TGGTGTATGAACATGTATCTGGG - Intergenic
1043122051 8:76338587-76338609 AGGTGGAGGTACTTGAATCATGG - Intergenic
1043190480 8:77215362-77215384 TGGTGTAAATACTCCTACCATGG - Intergenic
1044066452 8:87705492-87705514 AGGTGGAAGTAATTGAATCAGGG - Intergenic
1045912130 8:107423149-107423171 TGGTGTAAATACTCCTACCATGG - Intronic
1047831333 8:128633814-128633836 AGGTGAAAGTAATTGGATCATGG + Intergenic
1047965665 8:130044694-130044716 TGGTGTAAATATTTCTACCATGG - Intergenic
1048099613 8:131336153-131336175 AGGTGGAAGTAATTGAATCACGG - Intergenic
1048450557 8:134529764-134529786 TAGTGTAAATACTTCTACCATGG - Intronic
1048783712 8:138028490-138028512 TGTTATAAGTAATTTTATCAAGG + Intergenic
1050411529 9:5371387-5371409 AGGTGGAAGTAATTGAATCATGG + Intronic
1050787078 9:9416916-9416938 TTGTGAAAGTACTTGTATTGAGG - Intronic
1051430031 9:16972342-16972364 AGGTGTAAGTAATTGGATCATGG + Intergenic
1052109708 9:24566276-24566298 ATGTGTAAATACTTCTATCATGG + Intergenic
1052643088 9:31194403-31194425 AGGTGGAAGTAATTGGATCATGG - Intergenic
1054721949 9:68612744-68612766 TGTTGTAAGTCCTGGTATGATGG + Intergenic
1055444328 9:76367744-76367766 TGGTGTAAGTACTCTCATCATGG + Intergenic
1056906412 9:90653413-90653435 TGGTGGAGGTAATTGAATCATGG - Intergenic
1058454849 9:105129462-105129484 TGGTGTAAATACTTCTGCCATGG - Intergenic
1059504177 9:114782883-114782905 TGGTGTAAGGACTGGTATTAAGG + Intergenic
1060048912 9:120362921-120362943 AGGTGGAAGTAATTGGATCATGG - Intergenic
1061733659 9:132637056-132637078 TGAAGTAAGAACTGGTATCATGG + Intronic
1187690566 X:21862324-21862346 TGGTGTAAATACTTGCACCGTGG + Intronic
1187975465 X:24700826-24700848 TAATGTAGGTACTTGTATAAAGG + Intronic
1188283583 X:28300753-28300775 AGGTGGAAGTAATTGAATCATGG + Intergenic
1188514034 X:30965954-30965976 AGGTGGAAGTAATTGAATCATGG - Intronic
1189061780 X:37761419-37761441 TGGTGTAAATACTTCCACCATGG - Intronic
1189280125 X:39815369-39815391 TGGTGGGAGTATTTGCATCATGG + Intergenic
1189578028 X:42375851-42375873 TGGTGTAAATACTTCCACCATGG + Intergenic
1189680984 X:43515664-43515686 TGGTGTAAATATTCCTATCATGG - Intergenic
1190010203 X:46777898-46777920 TTGTGTGGGAACTTGTATCAGGG + Intergenic
1190889521 X:54556397-54556419 AGGTGGAAGTAATTGAATCATGG - Intronic
1191593745 X:62919007-62919029 AGGTGGAAGTAATTGGATCATGG + Intergenic
1191801906 X:65090806-65090828 TGGTGGAAGTGATTGGATCATGG + Intergenic
1193638538 X:83983533-83983555 AGGTGGAAGTAATTGGATCATGG - Intergenic
1194017805 X:88647099-88647121 TGGTGTAAATACTTTCACCATGG - Intergenic
1194904518 X:99558087-99558109 TGGTGCAAGTAGTTGCAGCATGG + Intergenic
1195090514 X:101454240-101454262 TGGTGTAAATACTTCCATCATGG + Intronic
1195765287 X:108289928-108289950 TGGTGTAAGTATTTCCAGCATGG - Intronic
1195871470 X:109490983-109491005 AGGTGGAAGTAATTGGATCATGG + Intergenic
1197163243 X:123347006-123347028 TGGTGTTAGTACTCTCATCATGG + Intronic
1197224704 X:123945340-123945362 TGGTGTAAATACTCCCATCATGG + Intergenic
1197390050 X:125851731-125851753 TGGTGTGAGTATTTACATCATGG - Intergenic
1197547207 X:127839487-127839509 AGGGGTAAGTAATTGAATCATGG - Intergenic
1197793171 X:130275309-130275331 TGGTGTTAATACTTTCATCATGG - Intergenic
1197827981 X:130611241-130611263 TGGTGTAAGTTCTGGTCTGAGGG - Intergenic
1198021321 X:132661063-132661085 AGGTGGAAGTAATTGAATCATGG - Intronic
1198119917 X:133582041-133582063 TGGTGTAAGTATTTCTATCCTGG + Intronic
1199117900 X:144014293-144014315 AGGTGGAGGTAATTGTATCATGG - Intergenic
1199231353 X:145439311-145439333 TGGTGTAAATACTTCTACAATGG - Intergenic
1199295437 X:146152646-146152668 TGGTGTAAGTTCTAGTCTGAAGG - Intergenic
1199925115 X:152454321-152454343 TGGTGTAAATACTTCTACCACGG + Intergenic
1200811250 Y:7487517-7487539 TGGTGTAAGTTCTTGTGTGATGG + Intergenic