ID: 1153212331

View in Genome Browser
Species Human (GRCh38)
Location 18:2780769-2780791
Sequence CCTGAACACCACATTCATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153212331_1153212338 27 Left 1153212331 18:2780769-2780791 CCTATATGAATGTGGTGTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1153212338 18:2780819-2780841 GCTGGTTCCAGCGTATCACTAGG 0: 1
1: 0
2: 0
3: 6
4: 47
1153212331_1153212335 9 Left 1153212331 18:2780769-2780791 CCTATATGAATGTGGTGTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1153212335 18:2780801-2780823 TTTCATGACCCAGTACAAGCTGG 0: 1
1: 0
2: 2
3: 18
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153212331 Original CRISPR CCTGAACACCACATTCATAT AGG (reversed) Intronic
908931843 1:69326212-69326234 CCTGGAAACCACATTTATAGTGG - Intergenic
915820155 1:159014559-159014581 CATGAACAACTCTTTCATATGGG + Intronic
1063039601 10:2323549-2323571 CATGAAAACGACATTCATCTTGG + Intergenic
1064324472 10:14336072-14336094 GCTGATCACCACATACATGTGGG + Intronic
1071100553 10:82031951-82031973 CCTTCACACCACCTTCATGTGGG + Intronic
1076211316 10:128647240-128647262 CCTGAACAACACATTCTTGCAGG - Intergenic
1078615734 11:12863904-12863926 GCTGAACAACAAATTCACATTGG - Intronic
1081240115 11:40695167-40695189 CCTGATCACCACAAGCATAATGG - Intronic
1084657043 11:70525733-70525755 CCTGAACAGCACACTCAGAAGGG + Intronic
1087147573 11:94827310-94827332 CCTGAACACCACTCTCATGGTGG + Intronic
1088697098 11:112376981-112377003 CCTGAACTCTCCTTTCATATTGG - Intergenic
1090010424 11:123040968-123040990 CCTGAACCTCACATTAATTTGGG + Intergenic
1090842031 11:130498734-130498756 CCTTACCACCACATTAATAAAGG - Intergenic
1098126404 12:67298623-67298645 ACTGAAGAGCACATTCATCTGGG + Intronic
1099907130 12:88784742-88784764 CCTTACCACCACATTAATAAAGG + Intergenic
1104032117 12:125072328-125072350 CCTGGACACCACAGTCAGAGGGG + Intronic
1111054795 13:82935392-82935414 ACTTAACACCACATCCATGTAGG + Intergenic
1111760293 13:92455131-92455153 CCAGGACTCCACATTCAGATAGG + Intronic
1114320327 14:21541845-21541867 CCCAAACACCACAATCACATGGG + Intergenic
1115302509 14:31900529-31900551 CCAGAAATCCACATTCTTATAGG - Intergenic
1117558655 14:56912462-56912484 CCTGAATACCACAGTCAAAGAGG - Intergenic
1119106632 14:71931504-71931526 CCTGGACTCCTCATTCACATGGG - Intergenic
1120279463 14:82420749-82420771 CCTAAACACTACCTTAATATGGG - Intergenic
1123569993 15:21594522-21594544 CCTGAAAACCTCTTTTATATAGG - Intergenic
1123606103 15:22029841-22029863 CCTGAAAACCTCTTTTATATAGG - Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1131865663 15:96706730-96706752 CCTGAAAATCACATACATCTTGG - Intergenic
1135570952 16:23549020-23549042 CCTGCACACCTCATTCCTCTTGG + Intronic
1138592412 16:58009159-58009181 CCTCACCACCACATTCATACAGG - Intronic
1140885894 16:79242266-79242288 CCTGAATACCACACACCTATGGG - Intergenic
1150178361 17:63087295-63087317 CCTGAACACTACATTACTAAAGG - Intronic
1153212331 18:2780769-2780791 CCTGAACACCACATTCATATAGG - Intronic
1156221896 18:35061162-35061184 AATGAAGAGCACATTCATATTGG + Intronic
1157299651 18:46470316-46470338 CCTGAACACCAGACTCCTAGTGG + Intergenic
1157785259 18:50475864-50475886 CCTGTACACAGCATTCATCTGGG + Intergenic
926973973 2:18494972-18494994 CTGGATCACCACATTCAAATGGG + Intergenic
929652045 2:43689828-43689850 CCTGAATAACACATTCAATTTGG - Intronic
930564262 2:52999666-52999688 CCTAAGCACCACAGTCATGTAGG - Intergenic
935519731 2:104089970-104089992 GCTGAACACCAAGTACATATGGG + Intergenic
936909005 2:117571503-117571525 CCTGATCACTACATTCTCATTGG + Intergenic
937018124 2:118624953-118624975 TCTGAACAACACACTCACATTGG + Intergenic
944153810 2:196590709-196590731 CCTGCAAAACACATTCATCTAGG + Intronic
944938940 2:204601927-204601949 CCTGCACACCACCTTCAGAGGGG - Intronic
945508218 2:210667556-210667578 CCTGAATACCACAGCCATATGGG - Intronic
1169679416 20:8193931-8193953 TCTGAACATCACATCTATATTGG - Intronic
1174537156 20:51260100-51260122 CCTGAACCCCAGATTCCTAGGGG + Intergenic
1181962003 22:26628908-26628930 TCAGAACACCCCATTCCTATGGG - Intronic
1182924418 22:34109064-34109086 CCTGAAGAGCACATGGATATTGG + Intergenic
952818865 3:37468633-37468655 CCTGAAAGCCACCTTCATCTTGG - Intronic
953821672 3:46212352-46212374 CCAGAACACCAAAGTCAGATTGG + Intronic
954603120 3:51887751-51887773 CCTGACCACCGCATTCAAATTGG - Intergenic
958024457 3:88034506-88034528 CCTGAACTACTCATTTATATTGG - Intergenic
960312671 3:116135587-116135609 CCTGACCAGTACATTCATCTTGG + Intronic
961369639 3:126421673-126421695 CCTGAACTCCACACCCAGATGGG + Intronic
961420653 3:126800492-126800514 CCTGAACCCCACTTTCAGAGGGG - Intronic
963212284 3:142706599-142706621 CCTGTTCACTACATTCAGATTGG - Intronic
965488222 3:169305143-169305165 CCTGAAAACCGCATTTTTATAGG + Intronic
967540314 3:190659472-190659494 ACTGAACATCACATTCAATTTGG - Intergenic
968836478 4:2968626-2968648 TCTGGAGACCACATTCTTATAGG + Intronic
969414359 4:7049014-7049036 CCTCAACACCATCTTCATAGCGG - Intronic
969897038 4:10315084-10315106 CCAGATCACCACATATATATAGG + Intergenic
971455550 4:26840691-26840713 CCTGAGCCCCACATTCAGAAGGG + Intergenic
971919841 4:32923558-32923580 CCTGAACACCACAAACTAATGGG + Intergenic
972204230 4:36752372-36752394 CCTCAAGACCACATTGAAATGGG - Intergenic
975077736 4:70233737-70233759 CCGCAACACCACATTCATCTTGG + Intronic
977365254 4:96059685-96059707 CCTGAACACCATAGGCACATAGG + Intergenic
977717654 4:100200047-100200069 CATGAAAACCATATACATATAGG - Intergenic
980772686 4:137397275-137397297 ACTGAACACCAAATTGATATGGG - Intergenic
988232126 5:28492674-28492696 CCTGAAGACCTCATTCCCATTGG + Intergenic
988500865 5:31782661-31782683 CCTGAACCCCAGAATCATCTGGG - Intronic
991974011 5:72168239-72168261 ACTGAACACCTCATTTATTTTGG - Intronic
993804680 5:92390281-92390303 CGTAAAAAACACATTCATATTGG - Intergenic
994541249 5:101101278-101101300 CCTGACCACCACATTACTAAAGG - Intergenic
1002380659 5:178826184-178826206 GCTGAATGCCACATTCATAATGG + Intergenic
1006758237 6:36436688-36436710 TCTGAGCTCCAAATTCATATTGG - Intronic
1008450944 6:51650356-51650378 CCTGGACATCACATATATATGGG + Intronic
1011728854 6:90239147-90239169 CTGGCACACCACATACATATGGG - Intronic
1017295720 6:152791363-152791385 CCAGAATAACACATTCATTTAGG + Intergenic
1033158784 7:138979365-138979387 CCAGATGGCCACATTCATATGGG + Intronic
1034013761 7:147559301-147559323 CCAGAGCACAACATTCACATTGG + Intronic
1039556682 8:38481404-38481426 CCTGAACACCACCTCCAAGTGGG - Intergenic
1042177289 8:66049010-66049032 CCTGAACACTAGTTTCATTTTGG + Intronic
1046887556 8:119384310-119384332 CATGACCACCACAGTCATTTGGG + Intergenic
1047304829 8:123644167-123644189 CCTGCACAACACAGTCATCTGGG - Intergenic
1047520232 8:125590416-125590438 CCTGAACTCCCCAGCCATATTGG + Intergenic
1056367562 9:85920802-85920824 CCTGAGCACCAAATGCAAATTGG - Intergenic
1057428725 9:94975647-94975669 CCTGCACGCCACATCCATGTGGG + Intronic
1061752275 9:132787727-132787749 CCTGTACACAACAATCATTTTGG - Intronic
1190171794 X:48116817-48116839 CCTGGAAACCCCATTCATTTAGG + Intergenic
1190193833 X:48299940-48299962 CCTGGAAACCATATTCACATAGG - Intergenic
1190655294 X:52606851-52606873 CCTGGAAACCCCATTCATTTGGG - Intergenic
1190658113 X:52630077-52630099 CCTGGAAACCCCATTCATTTAGG + Intergenic
1190663230 X:52674231-52674253 CCTGGAAACCCCATTCATGTAGG + Intronic
1190676193 X:52784251-52784273 CCTGGAAACCCCATTCATGTAGG - Intronic
1191192984 X:57686474-57686496 CCTGAATACAACATTCTGATGGG - Intergenic
1194712843 X:97256213-97256235 ACAAAAAACCACATTCATATTGG - Intronic
1195825494 X:108995498-108995520 CATGAACACTACATACAAATAGG - Intergenic
1198112489 X:133514017-133514039 GCTGCACACCACAATCATCTAGG + Intergenic
1198489081 X:137120217-137120239 CCTTAACACCACATTACTAAAGG + Intergenic
1199696529 X:150346493-150346515 CCTGACCATCACACTCATTTTGG - Intergenic
1199830932 X:151548338-151548360 CCTGAACACCACACGCGGATGGG - Intergenic
1201383808 Y:13416086-13416108 CCACCACACCACATTCATATGGG + Intronic