ID: 1153212509

View in Genome Browser
Species Human (GRCh38)
Location 18:2783316-2783338
Sequence CTTTGAGAAGGGCTGTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153212509 Original CRISPR CTTTGAGAAGGGCTGTCCCA GGG Intronic
900941219 1:5799903-5799925 CTATGAGGAGGGGTGGCCCAGGG + Intergenic
901068830 1:6507383-6507405 ATTTCTGAAGGGCTGCCCCATGG - Intronic
901441075 1:9278843-9278865 CTTTGTCAAGGGCTGTGCCAAGG + Intergenic
901839715 1:11946261-11946283 CTCTGAGAGGGGCTTCCCCAGGG + Intronic
902212563 1:14914236-14914258 CTTTGAGAACCGCTGCCCTAGGG + Intronic
902627867 1:17687481-17687503 ATGTGAGAATGGCTGGCCCAGGG + Intronic
902918039 1:19650562-19650584 CTCTGCAAGGGGCTGTCCCAAGG - Intronic
903400772 1:23045444-23045466 CTTTTAAAAATGCTGTCCCAAGG + Intronic
903730837 1:25494197-25494219 CTTTGAGAATTGCTGACCTAGGG + Intronic
903892182 1:26577262-26577284 GTTTGAGAAGTGCTGTTCTAGGG + Intergenic
904614766 1:31743737-31743759 CCTTGAGAGGGGGTGTCCAAAGG + Intronic
905485125 1:38290637-38290659 TTTTGAGAAGGGCTGGCTTATGG - Intergenic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
908838810 1:68257140-68257162 CCATGAGAAGGCCTGCCCCAGGG + Intergenic
910606299 1:89088607-89088629 ATTTGAGTAGGGCTGTCACATGG + Intergenic
910693767 1:89991168-89991190 ATTTGAGAAGTACTGACCCAGGG + Intergenic
911100568 1:94092783-94092805 CTAGGAGAAGGTCTGTCTCATGG - Intronic
913189718 1:116403234-116403256 GTGTGAGAAAGGCTGTCCCTGGG - Intronic
913360939 1:117979235-117979257 CCTTGAGAATGGCTGTCCTGAGG - Intronic
915560120 1:156682246-156682268 CTTTGAGAAGCTCTGTACCAAGG + Intergenic
916251336 1:162741535-162741557 GTTTGCAAAGTGCTGTCCCATGG - Intronic
917121482 1:171648264-171648286 CTTGGCCAAGGGCTATCCCATGG - Intronic
919157816 1:193789089-193789111 CTTTGAGAAGGGCAGACTCATGG + Intergenic
919975195 1:202605840-202605862 CTTTGGGCAGGGCTTTCTCAGGG - Intronic
920095063 1:203481163-203481185 CTGTGAGAAGCCCTGTCCCAAGG - Intronic
921628074 1:217400791-217400813 CTTAGAGAAGAGCTGTACCATGG + Intergenic
923555409 1:234997083-234997105 CTTTAGGAAGGGCTGTGTCAGGG + Intergenic
1062982093 10:1733279-1733301 CTTTGAAAAAGGCTGTTTCAAGG - Intronic
1063150927 10:3335655-3335677 ATTTGAGGAGGGCGGTCCCGGGG + Intergenic
1065862950 10:29886764-29886786 CTTTGAGGAGTGCTGTCCCCAGG - Intergenic
1066640691 10:37551593-37551615 CTTGGAGAACCGCTGCCCCAGGG - Intergenic
1067848320 10:49739816-49739838 CTTTGAGCTGGGCTATGCCATGG - Exonic
1068661391 10:59626949-59626971 CTTTGAGAAGCAATATCCCATGG - Intergenic
1069574648 10:69517762-69517784 CTGTGAGGAGGGCTCTGCCAGGG + Intergenic
1071369563 10:84937598-84937620 CTATGGGAAATGCTGTCCCATGG - Intergenic
1071710621 10:88045505-88045527 AGTTGAGAAGGGGTGTCACAGGG + Intergenic
1071979509 10:90989080-90989102 CTGTGTGAAGGGCTTTCCCCAGG - Intergenic
1074185409 10:111096538-111096560 CCAAGAGAAGGGCTGGCCCAGGG - Intergenic
1074784355 10:116826009-116826031 ATGTGTGAAGGGCTGTCACATGG + Intergenic
1076435178 10:130435883-130435905 CTCTGGCAAGGGTTGTCCCATGG + Intergenic
1076619142 10:131775850-131775872 CTAGGAGCAGGGCTGGCCCAGGG + Intergenic
1076884290 10:133254523-133254545 CTTAGGGCAGGGCTCTCCCAGGG - Intergenic
1076906483 10:133364858-133364880 CTTTGAGAAGGGCGGCACCATGG - Intronic
1077899375 11:6477056-6477078 CATTGGGAAGGGCAGCCCCAGGG - Exonic
1077957129 11:7032618-7032640 CTTTGAGAAGGGCTGTTTCCTGG + Intronic
1078010561 11:7570088-7570110 CCTTGAGTGGGGCTTTCCCATGG + Intronic
1078261561 11:9714582-9714604 CCTTCAGAAAGGCTGTACCAAGG + Intronic
1078855866 11:15206202-15206224 CAGTGGTAAGGGCTGTCCCATGG + Intronic
1081516106 11:43831800-43831822 CTTTGAAAAGGGAAGACCCAAGG + Intronic
1086115901 11:83249668-83249690 CTTTCAGGAGAGCTGTCTCAAGG + Intronic
1088720876 11:112590734-112590756 CTTTGAGGAGGACTGTCTGAGGG + Intergenic
1088720899 11:112590858-112590880 CTTTGAGAAGGACTCTCTGAAGG + Intergenic
1089340323 11:117752941-117752963 CTTTGCCCATGGCTGTCCCAGGG + Intronic
1089366475 11:117923976-117923998 CTTTACGAAGGGATGGCCCAGGG - Intronic
1089520162 11:119057666-119057688 GTTGGAGAATGGCTGTCCCTCGG + Intergenic
1090715481 11:129426756-129426778 CCTTGAGAAGGGCTGTGCCTTGG + Intronic
1091002790 11:131924503-131924525 CTTTGGGTAGAGCTGTCACATGG - Intronic
1091695192 12:2623629-2623651 CTTTGAGCAGGACTGTCTCTTGG + Intronic
1093075703 12:14756432-14756454 CTCTCAGAAGAGCTGCCCCACGG - Intergenic
1093115669 12:15207789-15207811 TTTTGTGAAGGGCTGTCATAAGG + Intronic
1094530026 12:31265704-31265726 CTTTCACCAGTGCTGTCCCACGG - Intergenic
1096523272 12:52195950-52195972 CTTTGAGCAGGGCTGATCCAGGG + Intergenic
1096765981 12:53890141-53890163 CTATTATAAGGGCTGTCCTAAGG + Intergenic
1097078511 12:56412603-56412625 CTTTGAGAAGCCCAGACCCAGGG - Intergenic
1098314150 12:69175936-69175958 CTCTTGGAAGGGCTGTTCCAAGG - Intergenic
1100240642 12:92707372-92707394 CTTTGAGAAAGGATGCACCAAGG + Intronic
1100888073 12:99094601-99094623 CTGTGAGAAGAGCTGTTACAAGG + Intronic
1102045373 12:109826652-109826674 CGTTGAGAAGGGGGGTCCTAGGG - Intronic
1102499283 12:113340319-113340341 CTTAGAGCATGGCCGTCCCAGGG + Intronic
1103597815 12:122034883-122034905 CTTTGAGAAAGGCTGCCCCAGGG + Intronic
1104390251 12:128385991-128386013 CTTCGTGAGGGGCTGTTCCAGGG - Intronic
1104579674 12:130001592-130001614 CTTTGAGATGGGCAGTTCCTTGG - Intergenic
1106184240 13:27394873-27394895 CTTTGAGAATGGCTGATCTAGGG + Intergenic
1106418723 13:29567964-29567986 CTCTGTGAAGAGCTGTCCCCTGG - Intronic
1113434802 13:110282654-110282676 CTTGGAGAAGCCATGTCCCAGGG - Intronic
1113807817 13:113120217-113120239 CATTGACAAGGGCTGTGGCAGGG - Exonic
1114596721 14:23918550-23918572 TTTTGAGAAGTGTTTTCCCATGG + Intergenic
1115415792 14:33131993-33132015 GATTGAGAAGGGCTGTCCTTAGG + Intronic
1117253942 14:53959554-53959576 CTTTGAAAAAGGCTGTCCCAAGG - Intergenic
1119349256 14:73950490-73950512 CCTGGAGAAGGGCTTACCCAAGG - Exonic
1119876476 14:78064042-78064064 CTTTGAGATGGGATGTGCCCTGG + Intergenic
1120392176 14:83923412-83923434 TTTTGAGAAGGGGTCTCACATGG - Intergenic
1122607661 14:102958172-102958194 CATGGATATGGGCTGTCCCACGG + Intronic
1123724939 15:23092323-23092345 GTGTGAGATGAGCTGTCCCATGG - Intergenic
1126892175 15:53218325-53218347 ATTGGCTAAGGGCTGTCCCATGG + Intergenic
1129118185 15:73378017-73378039 CTGTGACAAGGGCTGTGACAAGG + Intergenic
1129517894 15:76167944-76167966 ATGTTAGAAGGGCTGGCCCAGGG + Intronic
1130779264 15:87017403-87017425 CCTTGAGAAGCTCAGTCCCAGGG - Intronic
1132877533 16:2147035-2147057 CTTTCAGGATGGCTGGCCCAGGG - Intronic
1132891011 16:2204883-2204905 CCTTGAGACAGGCTGTCGCATGG - Intronic
1133000594 16:2849618-2849640 CTCTGCAAAGGGCTGTTCCATGG + Intergenic
1134054279 16:11159558-11159580 GTTTGAAAAGGGCTGTCATAGGG + Intronic
1134393646 16:13842691-13842713 CTTAGAGCAGGGCTGGCACATGG + Intergenic
1134909633 16:18012999-18013021 CTGTGAGAAGGACTGAACCAGGG + Intergenic
1135221943 16:20621503-20621525 CCTTCAGAAGGGCTGTTCCTGGG - Intronic
1136990541 16:35148870-35148892 CCCTGAGAGGGGGTGTCCCATGG - Intergenic
1137560725 16:49500443-49500465 ATTTGAGATGAGCTGTCCCACGG - Intronic
1138135634 16:54519080-54519102 ATGTGACAAGGGCTGTCCAAAGG - Intergenic
1138366546 16:56483312-56483334 ATTTGACAAGGGCTGTCCTAGGG - Intronic
1140671582 16:77284796-77284818 GATTGAGAAGGGCTGTCAGAGGG + Intronic
1141611169 16:85181950-85181972 CTTTGAGACGGACCGTCTCACGG + Intronic
1142592675 17:1013225-1013247 CTCTGAGCAGTGCTGACCCACGG - Intronic
1144131526 17:12251290-12251312 CCTTGGGAGGGGCAGTCCCAAGG + Intergenic
1144219860 17:13090084-13090106 CTTTGAAAAATGCTGGCCCATGG + Intergenic
1145120845 17:20258270-20258292 GTTTAAGAAGGACTGTCACAGGG + Intronic
1145208206 17:20995699-20995721 GTTTGAGAGGGGGTATCCCATGG + Intergenic
1146260282 17:31416302-31416324 CCATGTGAAGGGCTGTCCCACGG - Intronic
1147362785 17:39942182-39942204 CTTTGTGAAGTGCTGTGCAAAGG - Intronic
1151137594 17:71962220-71962242 TTTTAAAAATGGCTGTCCCAGGG - Intergenic
1151660786 17:75516909-75516931 CTGTGAGAGGGGCGGGCCCAGGG + Exonic
1152443483 17:80325457-80325479 CTTTCAGAAGGGTTGTTTCAAGG - Intronic
1152598668 17:81250582-81250604 CATTGAGAGGGTCTGTTCCAGGG - Intronic
1153212509 18:2783316-2783338 CTTTGAGAAGGGCTGTCCCAGGG + Intronic
1153297857 18:3564843-3564865 CTTAGAGAAGGGAGGTCACAGGG - Intronic
1153720291 18:7894784-7894806 CTTTGAGAAGCCCTCTCTCAAGG + Intronic
1155830637 18:30512128-30512150 ATGAGAGAAGGGCTGTTCCAGGG + Intergenic
1156526754 18:37775189-37775211 CTCTGAGAAGGGGTGTGGCAGGG + Intergenic
1158518591 18:58151264-58151286 ATTTGAGAATGGCTCTCCAAGGG + Intronic
1158668610 18:59455017-59455039 CATCGGGAAGGGCGGTCCCAGGG + Intronic
1158954553 18:62525314-62525336 CTTTGAGGAGGACTTTTCCATGG + Intronic
1161964090 19:7538695-7538717 CTGTCAGAGGGGCTGTCTCAAGG + Intronic
1162162792 19:8731232-8731254 GTTTGACATTGGCTGTCCCATGG + Exonic
1166229071 19:41415053-41415075 CCTGCTGAAGGGCTGTCCCAGGG - Intronic
1166407202 19:42529467-42529489 CCTTGTCAAGGGCTGCCCCAGGG + Intronic
1166566656 19:43769676-43769698 CTTGGAAGAGGGGTGTCCCATGG + Intronic
929960300 2:46491095-46491117 CTCAGAGAAGAGCTGCCCCATGG - Intronic
930321556 2:49861021-49861043 CATCCAGAAGGGCTGTACCATGG - Intergenic
935214058 2:100962534-100962556 CTTTGAGAAGGCCAGTGCCTGGG + Intronic
936059348 2:109284149-109284171 CTTACAGAGGGGCGGTCCCAGGG + Intronic
936559651 2:113526142-113526164 ATTTGAGAAGGGGTGTCTAAGGG + Intergenic
937640618 2:124206745-124206767 GTTTGAGAAGCTCTGTCCCAGGG + Intronic
938105765 2:128528807-128528829 CTTGCAGAAGGCCTGTCCCCCGG - Intergenic
938675724 2:133632046-133632068 ATTTTAAAAAGGCTGTCCCAAGG + Intergenic
939316253 2:140553672-140553694 CTTTGAGGAGGGCTGAATCAAGG + Intronic
939647302 2:144716540-144716562 CTTTCAGAAGGGCTGCCCTTTGG - Intergenic
942614050 2:177771355-177771377 CTTTGAGAAGCACTGACCTATGG + Intronic
944294804 2:198049995-198050017 CTTTGAGAAAGGCTTTGGCAAGG + Intronic
944543333 2:200775348-200775370 CTTTGGGAAGAGTGGTCCCAGGG + Intergenic
946147364 2:217741207-217741229 CTCTGAGCTGGGCTTTCCCAGGG + Intronic
946210274 2:218142313-218142335 ATTTTAGAAATGCTGTCCCATGG - Intergenic
947630346 2:231648689-231648711 CTTGGGGAAGAGGTGTCCCAGGG + Intergenic
947767226 2:232645455-232645477 TTTTGATCAGGGCTGTCCCAAGG - Intronic
948072042 2:235135592-235135614 ATTGGAGGAGGGCTGTCCAAGGG - Intergenic
948279758 2:236738024-236738046 CTTGGAGATGGGCTGCCCCAAGG - Intergenic
1172518770 20:35554058-35554080 CTTTGCAAAGGGCTGTCCTAAGG - Intronic
1173285922 20:41671384-41671406 ACTTGTTAAGGGCTGTCCCAGGG + Intergenic
1173587832 20:44197463-44197485 CTTTGAGAACTTCTGTTCCAAGG - Exonic
1173877759 20:46386132-46386154 GTGTGAGATGAGCTGTCCCACGG + Exonic
1175521131 20:59603659-59603681 CTTAGAGCGGGGCTGCCCCATGG + Intronic
1177469621 21:21542722-21542744 CTTTGAGAAGTGCTAGACCAGGG + Exonic
1179049293 21:37875071-37875093 CTGAGAGCAGGGCTGTCTCATGG + Intronic
1180011481 21:45054278-45054300 ATTTGCGACGGGCTGCCCCAGGG + Intergenic
1181499167 22:23306107-23306129 CAGTGGGAAAGGCTGTCCCAAGG - Intronic
1181926285 22:26361679-26361701 CTTTAAAATGGGCTGTCTCAAGG - Intronic
1182764934 22:32751710-32751732 CTCTGAGAGGGCCTGTCACAAGG - Intronic
1182980419 22:34665600-34665622 CTTTGAGATGGTGTGTCCCTTGG - Intergenic
1184861614 22:47176041-47176063 CTTTGAAAAGGGCTGTTCCGGGG + Intergenic
949492606 3:4604134-4604156 CTTTGAGAAGGGCTGTACATTGG + Intronic
949802695 3:7920927-7920949 CTTCATGAAGGGCTGTCCCCTGG + Intergenic
950005366 3:9687931-9687953 CTCTGAGAAGGGCTGCTCCCTGG + Intronic
950160339 3:10755949-10755971 CTTTGCGAAGTCCTGTCCCAAGG - Intergenic
950672591 3:14536200-14536222 CTTAGAGCAGGCCTGGCCCAGGG - Intronic
952857600 3:37785091-37785113 CTCTGAGGAGGGCTGTCCTGGGG - Intronic
952904104 3:38128460-38128482 CTTGGAGAGGGGCAGTGCCATGG - Intronic
954671561 3:52293916-52293938 CTAGGACAAGGGCTGTCACAAGG - Intergenic
954812520 3:53256770-53256792 CTTTGAGACGGGGTCACCCATGG + Intergenic
954977230 3:54707673-54707695 CTTTGAGTAAGGCTGTCCATAGG + Intronic
963629130 3:147711634-147711656 CCTTGAGAAGAGCAATCCCAAGG - Intergenic
963858908 3:150286431-150286453 CTTTGATAAAGGCAGTCACAAGG + Intergenic
966616779 3:181921855-181921877 GTTTGGGCAGGGCTGGCCCAAGG + Intergenic
968183223 3:196612615-196612637 GTATGGAAAGGGCTGTCCCAAGG - Intergenic
970948881 4:21728767-21728789 CCTTAAGAAGGGCTTCCCCAGGG - Intronic
977543911 4:98352293-98352315 CTTTTAGTAGGGCTGTAACAGGG + Intronic
977725343 4:100290233-100290255 TTTTGCCAAGGGCTGTTCCATGG + Intergenic
980996818 4:139786916-139786938 CTCTGACAAGGGATGTCCCCGGG - Intronic
981517075 4:145620938-145620960 CTTTGAGAACCACTGTCCTAGGG + Intronic
982668079 4:158291168-158291190 CTTGGAGAAGGTCTGGCCCCCGG - Intergenic
982938006 4:161509576-161509598 CTTTGAGACTGGCTTTCACAGGG + Intronic
984766095 4:183401532-183401554 CTTTCATAAGGGCTGTGCCCAGG + Intergenic
987151741 5:15047557-15047579 TTTTAAGAAGGGCTGTCAAATGG + Intergenic
987307390 5:16649987-16650009 CTTTGAGAAATGCAATCCCAGGG - Intergenic
989392458 5:40915502-40915524 CTGTGAGATAGGCTTTCCCAGGG + Intronic
992998023 5:82351505-82351527 CATTGAGATGGACTGTCCCAAGG - Intronic
999835387 5:155364728-155364750 GTTTGAGAAGCACTGTCCTAGGG + Intergenic
1000204786 5:159048455-159048477 CTTGGTTGAGGGCTGTCCCAGGG - Intronic
1001514074 5:172342780-172342802 CTTGGAGAAGGGCTGTGTCCGGG + Intronic
1001718894 5:173840389-173840411 CAGTGAGAAGGGCTGTGCCTTGG - Intergenic
1002563624 5:180098416-180098438 GTGTGAGTAGGGCTGCCCCAGGG - Intergenic
1003696815 6:8415277-8415299 CTTAGAGAAAGGCTTTCCTATGG + Intronic
1004204948 6:13583818-13583840 CTTTGAGAAGCACTGCTCCAAGG + Intronic
1006740230 6:36302660-36302682 CTTTGAGAAGCACTGCACCAAGG - Intronic
1007739193 6:44000760-44000782 CCTGGAGAAGCGCTTTCCCACGG - Intronic
1008387055 6:50903630-50903652 CTTTGAGGAAGGCTGCTCCAGGG - Intergenic
1009881456 6:69571295-69571317 CTTCCAGATGGCCTGTCCCAGGG + Intergenic
1010730221 6:79382929-79382951 ATATGAGAATGGCTGTGCCATGG - Intergenic
1015148584 6:130015196-130015218 ATTTGTGAAGGGCTGGCTCATGG + Intronic
1017538000 6:155369253-155369275 ATTTAAGAAGAGCTGTCCCAGGG - Intergenic
1017657045 6:156639946-156639968 CTTTGAGAAGAGCAATCCAAAGG + Intergenic
1017900979 6:158718364-158718386 ATTTGGGCAGGGCTGGCCCAAGG + Intronic
1017917308 6:158841693-158841715 CTTTGAGAAGGGCTATCTGATGG - Intergenic
1018315251 6:162550290-162550312 TATTAGGAAGGGCTGTCCCAAGG + Intronic
1018487135 6:164252396-164252418 CTCTGAGAAGAGCTGACACAAGG - Intergenic
1019432442 7:1005534-1005556 CTTGGAGCTGGGCTGTCCCTCGG + Intronic
1020389888 7:7646713-7646735 CTTGGAGTTCGGCTGTCCCATGG + Intronic
1022533857 7:31083822-31083844 ATTTGAGAAGTGCTGATCCAGGG + Intronic
1022889505 7:34682053-34682075 CTTTGAGAAGCACTTTCCAAAGG + Intronic
1023689645 7:42772827-42772849 CTGTGGGAGGGGCTGTCCGAGGG - Intergenic
1023856749 7:44188786-44188808 CTTTGAGAAGGGTCTTGCCAGGG - Intronic
1024030480 7:45456049-45456071 CTCTGAGAAGGGCTTTCTCCAGG + Intergenic
1024247636 7:47482141-47482163 CTTTGAGAAGGCAGGTGCCAGGG - Intronic
1024652582 7:51418175-51418197 GTGTGGGGAGGGCTGTCCCAGGG + Intergenic
1025037764 7:55608819-55608841 GTGTGGGGAGGGCTGTCCCAGGG + Intergenic
1026566232 7:71491812-71491834 CTTTGAGATGCACTGTCCTACGG + Intronic
1029978694 7:104858250-104858272 CTTCGAGAGGGGATCTCCCAAGG - Intronic
1031210999 7:118825950-118825972 GTTTGAGAAGCCCTGTCCTAGGG + Intergenic
1031977308 7:128102305-128102327 GTTTGAGAAGCGCTGCTCCAGGG - Intergenic
1033029077 7:137807540-137807562 GTTTGAGAAGTGCTGGCCCAGGG - Intronic
1033145352 7:138866450-138866472 CTTTGAGAAGGGATTTGCGATGG - Intronic
1033267888 7:139901769-139901791 CTCTGAGAAATGCTGTCCTAGGG - Intronic
1033705039 7:143878417-143878439 CTGTGTGAAGGGCTTTCTCAAGG - Intronic
1039053087 8:33512518-33512540 CTTGGAGAAGGCCTGTCCAAAGG + Exonic
1041602133 8:59731718-59731740 CTTTGAGAAGCCCAGTCCCAGGG + Intergenic
1048044301 8:130758843-130758865 CTGAGTCAAGGGCTGTCCCATGG - Intergenic
1049720186 8:144112059-144112081 CTGGGAGAAGTGCTGGCCCAGGG - Exonic
1049893218 9:90230-90252 ATTTGAGAAGGGGTGTCTAAGGG - Intergenic
1053199462 9:36142802-36142824 CTCTGAGAGGGCCTGCCCCAGGG - Intronic
1053734429 9:41090284-41090306 ATTTGAGAAGGGGTGTCTAAGGG - Intergenic
1054693957 9:68341289-68341311 ATTTGAGAAGGGGTGTCTAAGGG + Intronic
1057565364 9:96161810-96161832 CTTTGAGAAGAGAGGACCCAGGG - Intergenic
1057565544 9:96163270-96163292 GCTTGAGAAGGACTGTCCCTAGG + Intergenic
1058186565 9:101862234-101862256 CTGTTAGAAGGGATGTCTCATGG + Intergenic
1058228345 9:102394533-102394555 CATTGAGAATGGCTGACCCCAGG - Intergenic
1058737392 9:107906422-107906444 ATTTTAGAAGGGCTGTAACAAGG - Intergenic
1058868077 9:109179953-109179975 CTTTGAGCAGGGCAGTGACAGGG - Intronic
1059960904 9:119563570-119563592 CTTTGAGTAGAGGGGTCCCAGGG - Intergenic
1060206995 9:121688019-121688041 CTTTGAGCAGGCCTGGCCCTAGG + Intronic
1060422105 9:123476592-123476614 CTTTGTGAAGGTCTAACCCATGG - Intronic
1061409186 9:130409410-130409432 AGTTGAGAGGGGCTGCCCCAGGG - Intronic
1061422671 9:130480652-130480674 TTATGAGAAGAGCTGTCCAAGGG + Intronic
1062471952 9:136710009-136710031 CCTGCAGGAGGGCTGTCCCAGGG - Intergenic
1189298912 X:39937986-39938008 CTTTGAGGAGGGCTGGCCAGGGG - Intergenic
1189420733 X:40855502-40855524 ATTTGAGAAGCACTGCCCCAGGG - Intergenic
1190844989 X:54183150-54183172 CCTGGAGAAGCGCTGTCCCGGGG - Exonic
1193205161 X:78739539-78739561 CCTTGAGCAGTGCTGCCCCATGG + Intergenic
1194723681 X:97369888-97369910 CATTGAGAATGACTGTCACATGG - Intronic
1195422343 X:104689471-104689493 CTTTGACAAGAGCTGCCCCTAGG + Intronic
1195668634 X:107451298-107451320 CTTCGAGAAGGGCGCCCCCAAGG - Intergenic
1195707475 X:107748468-107748490 CTTTGGGAAGGGCTGACCCAAGG - Intronic
1199542090 X:148968468-148968490 ATTTGAGAACGACTGTCCTAGGG + Intronic