ID: 1153213078

View in Genome Browser
Species Human (GRCh38)
Location 18:2789412-2789434
Sequence CTGTGTCAAGGCTAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153213074_1153213078 8 Left 1153213074 18:2789381-2789403 CCTTTAATTGAATTTGTAATCTG 0: 1
1: 0
2: 1
3: 21
4: 278
Right 1153213078 18:2789412-2789434 CTGTGTCAAGGCTAAGTGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153213078 Original CRISPR CTGTGTCAAGGCTAAGTGGA AGG Intronic
900095067 1:936898-936920 CTGTGTGAAGGCACAGGGGAGGG - Intronic
900815034 1:4837180-4837202 TTCTGTCAAGGCCAAGAGGAGGG - Intergenic
901330583 1:8404789-8404811 CCGTGTCAGGGCGAGGTGGAAGG + Intronic
902165093 1:14563709-14563731 CTGTGGCAGGGCTGAGAGGATGG - Intergenic
902602789 1:17551433-17551455 ATGTGCCAAGGCTCAGGGGAGGG + Intronic
903025812 1:20429324-20429346 CTGTGGCACTGCAAAGTGGAAGG - Intergenic
904239608 1:29135202-29135224 CAGTGTCAAGGCTCTGAGGAGGG + Intergenic
907832175 1:58075385-58075407 CTGTGTCACTTCCAAGTGGAAGG + Intronic
908314291 1:62917716-62917738 CTGGGTAAAGGCTAACTTGAAGG - Intergenic
909809326 1:79911936-79911958 CTTTGTAAAGGTTAAGTGTAAGG + Intergenic
912059804 1:105653550-105653572 CTTTGTGAAGCCTAAGTGGGAGG + Intergenic
912333829 1:108844470-108844492 CTTTGCCAAGGCCCAGTGGAAGG + Intronic
912677471 1:111698219-111698241 ATGTGTCAAGTCTATGTGCATGG - Intronic
913566091 1:120074039-120074061 TTGGGTCTAGGCTCAGTGGAAGG - Intergenic
913632039 1:120719514-120719536 TTGGGTCCAGGCTCAGTGGAAGG + Intergenic
914286679 1:146233398-146233420 TTGGGTCTAGGCTCAGTGGAAGG - Intergenic
914547710 1:148684139-148684161 TTGGGTCTAGGCTCAGTGGAAGG - Intergenic
914618801 1:149386215-149386237 TTGGGTCTAGGCTCAGTGGAAGG + Intergenic
917499787 1:175575818-175575840 CAGTGAGAAGGCTAAGTGGTGGG + Intronic
921185565 1:212666679-212666701 CTGGGTCAAGGCTAAGGTGCCGG - Intergenic
922120437 1:222662046-222662068 CTTTCTCAAGGATCAGTGGACGG + Exonic
922744623 1:228037193-228037215 GTGTGTGAAGGCTGAGTGGGAGG - Intronic
923226739 1:231944656-231944678 CTGCGTTAAGGGTATGTGGAAGG - Intronic
923655148 1:235909491-235909513 GTGTTTCAAGGCCAAGCGGATGG + Intergenic
1064318516 10:14280014-14280036 CTGTAACATGGCAAAGTGGAAGG - Intronic
1064776355 10:18782057-18782079 TTGTGTCAGGGACAAGTGGATGG + Intergenic
1065178335 10:23100140-23100162 CTTTGCCAAAGCTAAGAGGAGGG + Intronic
1067430275 10:46238141-46238163 CTATGGCAAGGCTAAGGGAATGG - Intergenic
1068968680 10:62939749-62939771 CTATTTCATGGCTAGGTGGAGGG - Intergenic
1070264533 10:74889595-74889617 CTGGAGCAAGGCTCAGTGGATGG + Intronic
1071120741 10:82274933-82274955 CAGAGTCTAGTCTAAGTGGAAGG - Intronic
1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG + Intronic
1072789197 10:98305264-98305286 CTGTGCCCTGGCTAAGAGGATGG - Intergenic
1077847614 11:6042662-6042684 CTGTGTCGAGGAGAAGGGGAAGG - Intergenic
1078526404 11:12104834-12104856 ATCTCTCAAGGCTCAGTGGAAGG + Intronic
1079967273 11:26994569-26994591 CTGTGTCAAGGCTACTTCGATGG + Exonic
1080388078 11:31821591-31821613 TTGTGACAAAGCTAACTGGAAGG - Intronic
1080957944 11:37123428-37123450 CTGTGTCAAAGAGAAGTAGATGG - Intergenic
1081933160 11:46886471-46886493 CTGTGTCAAAGCTGATTCGACGG + Exonic
1082800025 11:57407520-57407542 GTCTGCCAAGGCTAAGTGCAAGG + Intronic
1083149258 11:60781658-60781680 CGGGGTCAAGTGTAAGTGGAGGG - Intergenic
1083369379 11:62166246-62166268 CTGTGTCAGGGCCAAGGAGATGG + Intergenic
1089019961 11:115203319-115203341 GTGTGTGAATGCTCAGTGGAAGG + Intronic
1095629830 12:44362480-44362502 CTGTATCAAGGCTTAGTAGGGGG + Intronic
1095670041 12:44848161-44848183 CAGTGTTAAGGCTAAGGAGAGGG + Intronic
1096126398 12:49122984-49123006 CTTTGTCAAGTCTCAGGGGAGGG - Intergenic
1102255758 12:111414075-111414097 CTGTGTCAAGGCTGGGTGTGGGG + Intronic
1102470554 12:113157668-113157690 CTGTGTCAGGGCTAGGAGGCAGG - Exonic
1104167439 12:126247256-126247278 CTGTGCAAAGGCTCAGTGGCTGG + Intergenic
1105604511 13:21915761-21915783 CTGTGTGAGGGCGGAGTGGATGG - Intergenic
1106670607 13:31900508-31900530 CTATGACAAGGCTGACTGGAGGG + Intergenic
1111478117 13:88781715-88781737 CTATGATGAGGCTAAGTGGAGGG + Intergenic
1111775801 13:92659891-92659913 CTGTGGCAAGGCAGAGTGGGAGG + Intronic
1118616364 14:67576992-67577014 CTGTGTCAAGTCTGGATGGAGGG - Intronic
1119847225 14:77839543-77839565 CTGTGTCAAGGCCACCTGCAGGG + Intronic
1122793533 14:104194478-104194500 CTGTGTCAGGGCTGTGTTGAGGG + Intergenic
1124693259 15:31843352-31843374 CTGTGTTAAGGCTTAATGGTTGG - Intronic
1124969581 15:34473190-34473212 CTGTGGCAAGGCAGAGTGGAAGG + Intergenic
1128179918 15:65593139-65593161 CTGGGTCATGGCTACTTGGAAGG + Intronic
1130352488 15:83104991-83105013 CTGTGTCTAGGTTGAGCGGAAGG + Intergenic
1130726637 15:86445793-86445815 CTGAGTCACAGCTCAGTGGAGGG - Intronic
1132189712 15:99842321-99842343 CTGTGGCAAGGCAGAGTGGGAGG - Intergenic
1137729369 16:50678724-50678746 CTGTGACCCGGATAAGTGGAAGG + Intronic
1140224277 16:73066096-73066118 CTGTGTCAAGGCTGCGGGCAGGG + Intergenic
1142475264 17:184972-184994 CTCTGGCAAAGTTAAGTGGATGG + Intergenic
1147850016 17:43435188-43435210 CAGTGTCAAGGGGAGGTGGATGG + Intergenic
1149225090 17:54460784-54460806 CTGTATCAAGGTTAAGTATAGGG + Intergenic
1150589189 17:66547215-66547237 CTGTTTGAAAGATAAGTGGAGGG - Intronic
1150787392 17:68174117-68174139 CTGAGTCAAAGCCAAGGGGAAGG - Intergenic
1153213078 18:2789412-2789434 CTGTGTCAAGGCTAAGTGGAAGG + Intronic
1155404568 18:25473673-25473695 CTGTCTTATGGCTAAGAGGAGGG + Intergenic
1156336072 18:36172675-36172697 CTGTGGGCAGGCAAAGTGGAAGG - Intronic
1158542112 18:58366605-58366627 CTGTGTAAAGGCAAATTGTAAGG + Intronic
1163479935 19:17549247-17549269 CAGTGTCCAGGCTCAGTGAAGGG + Intronic
1164736742 19:30546597-30546619 CTGTGTCTAGTCTCAGCGGAAGG - Intronic
1166582759 19:43916814-43916836 CAGATTCAGGGCTAAGTGGATGG + Intronic
1166745899 19:45141745-45141767 CTGTGTGAAGGCTGGGTGGAGGG + Intronic
1167254335 19:48418392-48418414 GTGTGACAAGGCTGAGTGGCAGG + Intronic
926060960 2:9804464-9804486 CTGTGTCCACACTTAGTGGAAGG - Intergenic
927647370 2:24886551-24886573 CTGTGTCAAGGCGAAGCAGGAGG - Intronic
932758991 2:74427333-74427355 CTGTTTCAAGATTATGTGGAAGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
938391719 2:130911972-130911994 CTATGTCAATGCTGAGAGGATGG + Intronic
939622291 2:144435236-144435258 CTGTGTCACGTCTAAGCTGAAGG - Intronic
940440558 2:153711058-153711080 CTGTGGCAAGGCTCAGAGAAAGG - Intergenic
941224486 2:162829944-162829966 CTGTGTCCAGGATATATGGAAGG - Intronic
941514226 2:166451665-166451687 ATGTGTCCAGGCTAAATAGATGG - Intronic
947169659 2:227298572-227298594 TTGTGGCAATGCTAAGTGAAGGG + Intronic
1169667978 20:8060271-8060293 CTGTGTAATAGGTAAGTGGAGGG + Intergenic
1172762809 20:37333890-37333912 GTGAGTCAAGGCCAAGGGGAAGG + Intergenic
1174034075 20:47655813-47655835 CTGGCTCCAGGCTAACTGGAAGG + Intronic
1174444199 20:50579693-50579715 CTCTTTCAAGGATCAGTGGAAGG + Exonic
1174657319 20:52182386-52182408 CCGTGTAAATGCTAAGAGGAGGG + Intronic
1179669440 21:42935879-42935901 CTGTGTTATGTCTAAGTGGCAGG - Intergenic
952512722 3:34073192-34073214 CTGTGCCAAGGCAAAAGGGATGG + Intergenic
952654517 3:35768967-35768989 CTATGTTAAGCCTAAGTGAAAGG + Intronic
953808470 3:46091956-46091978 CTGTGTCATTGCAAAGTAGAAGG + Intergenic
954325296 3:49860170-49860192 CTTTGCCAGGGCCAAGTGGAAGG - Exonic
956299646 3:67757385-67757407 CTCTGTCAAGGATCAGTTGAGGG - Intergenic
956806485 3:72818804-72818826 CTGTGAGAAGGCTATGTGGCAGG + Intronic
959767024 3:110043706-110043728 ATATGTAAAAGCTAAGTGGAAGG - Intergenic
960993816 3:123328401-123328423 CTGGGTCAAGGCTCAGGGAAGGG + Intronic
962240028 3:133744448-133744470 CAGGGGCAAGGCTAACTGGAAGG - Intergenic
966978970 3:185112437-185112459 GTGTTTCAAGTCTAAATGGATGG - Intronic
967036194 3:185649804-185649826 GTGTGTCAGGGCTAAGGGGATGG + Intronic
971015317 4:22483075-22483097 CTGTGTCACAGCTATGAGGAAGG - Intronic
971397240 4:26240022-26240044 CTCTGCCAAGGCTCAGAGGACGG - Intronic
973651618 4:53002584-53002606 CTGTATCAAGGCTCATAGGAGGG - Intronic
976202962 4:82598012-82598034 CTGTGGGAAGGCAAAGTCGAAGG - Intergenic
977911693 4:102544920-102544942 ATGTGTCAAGGAAGAGTGGAGGG - Intronic
978912658 4:114082718-114082740 CTGTGTCAAAGCTAAAGGAAAGG - Intergenic
980063286 4:128155277-128155299 CTGTGTGAAGGCACAGTAGAGGG + Intronic
981576725 4:146213414-146213436 CTGTGTCAGGACCCAGTGGAGGG + Intergenic
987396712 5:17431365-17431387 CTGGGTAAAGGCTAAATGGATGG + Intergenic
988837175 5:35044849-35044871 CTGTGGCAAGGCTGCCTGGAGGG + Intronic
989481269 5:41932874-41932896 CTGTGTTAACACTAAGTGGCTGG - Intronic
991671400 5:69051871-69051893 CTGTGTCATGGGTATGTAGATGG + Intergenic
997942493 5:138170724-138170746 CTGTCTCAAGTCTAAAGGGACGG + Intronic
998393191 5:141800977-141800999 CTTTCTCAAGGCCAAGGGGAAGG + Intergenic
1000725006 5:164758839-164758861 CTGTGTCAAGGCTCAGATCAGGG - Intergenic
1004509096 6:16270186-16270208 CTGTGTCAAGGAGAGGTTGAAGG - Intronic
1005404399 6:25470729-25470751 CTGTGTCTTTACTAAGTGGAAGG + Intronic
1006854946 6:37126149-37126171 CTGGGGGAATGCTAAGTGGAAGG - Intergenic
1008494984 6:52124167-52124189 CTGTGAGAAGGCTAAGATGAGGG + Intergenic
1009777920 6:68229814-68229836 CTGTGTCACATCTAAGAGGATGG - Intergenic
1015017177 6:128427735-128427757 CTGTGTGGAGGCTATGTGGAGGG - Intronic
1018188351 6:161287278-161287300 CAGAGTCAAGGCTGAGTGCAAGG + Intergenic
1019464403 7:1179317-1179339 CTTTGTCAAGGCTCGGCGGACGG + Intergenic
1023562790 7:41493153-41493175 TAATGTCAAGGTTAAGTGGATGG - Intergenic
1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG + Intronic
1035641732 8:1189284-1189306 CAGTGTCAAGGCCAACTGCAAGG + Intergenic
1037390660 8:18387906-18387928 CTGTCTCAGACCTAAGTGGAGGG - Intergenic
1037933716 8:22900121-22900143 ATGAGACAAGGCTAAGTGGCTGG + Intronic
1038880824 8:31609223-31609245 CTGTGTCATGGCTAAGAGCATGG + Intergenic
1041346528 8:56904459-56904481 CTGGATCAAGGTTCAGTGGAGGG + Intergenic
1042661146 8:71155823-71155845 ATGTGTAAAGGCTAAAAGGAGGG + Intergenic
1049178773 8:141209730-141209752 CTGTGGCAAGGCCATGTGGAGGG + Intronic
1051251218 9:15160954-15160976 CTGTGTCATCCCAAAGTGGAAGG + Intergenic
1052969408 9:34367893-34367915 CTCTGTTAAGGCAATGTGGAAGG - Exonic
1059052988 9:110948620-110948642 CTGTGTCAGTCCTAAGAGGAAGG + Intronic
1059084686 9:111287399-111287421 ATATGTCATGGCTAAGTGGCAGG - Intergenic
1060052887 9:120389840-120389862 CTGTGTGAAAGCCAAGTGCAGGG + Intronic
1060539487 9:124419943-124419965 CTGTGTCCAGGCCCAGGGGAGGG - Intergenic
1061288536 9:129637955-129637977 CTGCCTCAAGGAGAAGTGGAGGG + Exonic
1062108546 9:134768957-134768979 CTGTGTCTAAGCTGTGTGGAGGG + Intronic
1186073317 X:5847629-5847651 CTGTGTCAGGGCTAATTGCATGG - Intronic
1187500347 X:19833606-19833628 CTGTGGAAAGGCGAGGTGGATGG - Intronic
1197092909 X:122559652-122559674 CTGTGTCACTCCTAGGTGGATGG - Intergenic
1199348739 X:146774567-146774589 CTGTGTTGAGACCAAGTGGAAGG - Intergenic
1199988520 X:152969999-152970021 TTCTGTCAAGGCAAAGGGGAGGG - Intronic
1201428176 Y:13877112-13877134 CTGTGTCAAGGAAAGGGGGAAGG + Intergenic