ID: 1153213495

View in Genome Browser
Species Human (GRCh38)
Location 18:2794161-2794183
Sequence CTGGCCTATCCAGTTTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153213495_1153213504 21 Left 1153213495 18:2794161-2794183 CCATTTTAAACTGGATAGGCCAG 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1153213504 18:2794205-2794227 AGCACTTCGGGAGCCCAAGATGG 0: 3
1: 122
2: 5935
3: 73477
4: 161424
1153213495_1153213500 9 Left 1153213495 18:2794161-2794183 CCATTTTAAACTGGATAGGCCAG 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1153213500 18:2794193-2794215 TCCTGTAATCCCAGCACTTCGGG 0: 156
1: 13462
2: 308761
3: 279137
4: 274435
1153213495_1153213499 8 Left 1153213495 18:2794161-2794183 CCATTTTAAACTGGATAGGCCAG 0: 1
1: 0
2: 0
3: 13
4: 169
Right 1153213499 18:2794192-2794214 CTCCTGTAATCCCAGCACTTCGG 0: 5428
1: 199502
2: 273806
3: 196586
4: 162484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153213495 Original CRISPR CTGGCCTATCCAGTTTAAAA TGG (reversed) Intronic
900274133 1:1812473-1812495 CTGGCCTATCCAGAAAAAAACGG + Intronic
901186768 1:7378713-7378735 CTGACCTGTACACTTTAAAATGG + Intronic
903844778 1:26272497-26272519 CTGACGTATCCACTTTAAGATGG + Intronic
904488498 1:30843709-30843731 CTGTCCCCTCCAGTTTAATATGG + Intergenic
905017440 1:34787300-34787322 CTGGCTTATCCACCTTCAAATGG - Intronic
907115561 1:51965337-51965359 CTGAACTATACTGTTTAAAAGGG + Intronic
909500274 1:76327507-76327529 AAGGCCTATCCAGTTTATGAAGG + Intronic
909563769 1:77032909-77032931 CTGGCCTCTGCTGTTTGAAATGG - Intronic
917187870 1:172381916-172381938 CTGGCCTTTCCTCTTTGAAATGG + Intronic
924385682 1:243496437-243496459 CTGCCCTCTCCAGTTACAAATGG + Intronic
1066226171 10:33385857-33385879 CTTGCCTCTCCAGTTTTATAAGG - Intergenic
1067998475 10:51303387-51303409 CAGGCCTATTCAGTTTAAGATGG + Intronic
1068205882 10:53852638-53852660 CTGACATATCCATTTTACAATGG - Intronic
1070348071 10:75564951-75564973 ATGGACCAACCAGTTTAAAAGGG - Intronic
1072296590 10:94014305-94014327 CTGACCTGTACACTTTAAAATGG - Intronic
1073581405 10:104669270-104669292 CTGAACTATACACTTTAAAATGG - Intronic
1074710674 10:116174979-116175001 CTGTCCTAATCAGTTTAAAGGGG + Intronic
1074961973 10:118455124-118455146 ATGGCCTATCCAGTATAGTAGGG + Intergenic
1075283605 10:121163106-121163128 CTGGCCTTTCTAGTTTAAGAGGG + Intergenic
1075793069 10:125099385-125099407 CTGGGCCCTCCAGATTAAAAGGG + Intronic
1076519281 10:131070479-131070501 TTCACCTATCCAGGTTAAAAAGG - Intergenic
1078448359 11:11421827-11421849 CTGGACTATGCAGTTAGAAAAGG + Intronic
1079127337 11:17727340-17727362 CTGAACTATGCATTTTAAAAAGG - Intergenic
1079280124 11:19079730-19079752 CTGAACTACCCTGTTTAAAACGG - Intergenic
1080331278 11:31142273-31142295 CAGTCCTATCCAATTTGAAAGGG - Intronic
1080768562 11:35319277-35319299 ATGGTCTATCCACGTTAAAAAGG - Intronic
1084286833 11:68137188-68137210 CTACCTTATACAGTTTAAAAAGG + Intergenic
1084881344 11:72173629-72173651 CTGACCTGTACAGTTAAAAATGG - Intergenic
1086229884 11:84555766-84555788 CTGAACTGTACAGTTTAAAATGG + Intronic
1088359027 11:108971866-108971888 CTGGGCTGTACACTTTAAAATGG - Intergenic
1090171282 11:124607286-124607308 ATGGCCTAACCAGTGTAATAAGG + Intergenic
1091546819 12:1506735-1506757 CTGACCTGTACAGTTAAAAATGG + Intergenic
1093476534 12:19561434-19561456 CTGGACAATCCTGTTTAAAAGGG + Intronic
1094135955 12:27126429-27126451 CTGAACTATACACTTTAAAATGG + Intergenic
1094584598 12:31766206-31766228 CTGACCTACACACTTTAAAATGG + Intergenic
1096376524 12:51116009-51116031 CTGAACTATCCACTTAAAAATGG + Intronic
1098858713 12:75683547-75683569 CAAGCCTACCCAGTTTCAAAGGG + Intergenic
1099067760 12:78005389-78005411 TTGGCCTTTTCAGTTTTAAAGGG - Intronic
1099573210 12:84352103-84352125 CAGGCCTATCCACTTTTGAAGGG - Intergenic
1099790422 12:87327079-87327101 CTGGACTATCTAGTTTTATAGGG - Intergenic
1102137518 12:110587601-110587623 CTGAACTATACACTTTAAAAAGG + Intergenic
1104204737 12:126627716-126627738 CTGACCTATACACTTAAAAATGG + Intergenic
1105517707 13:21105108-21105130 CTAGCCAATATAGTTTAAAAAGG + Intergenic
1105970024 13:25420262-25420284 CTGGCCAATTCATTCTAAAATGG - Intronic
1108206577 13:48095668-48095690 CTGAACTATCCACTTAAAAATGG - Intergenic
1112424206 13:99281914-99281936 CTAATGTATCCAGTTTAAAAGGG + Intronic
1112484162 13:99804794-99804816 CTGAACTATACAGTTAAAAATGG - Intronic
1118698528 14:68410105-68410127 CTGTCCTATGCATTATAAAATGG + Intronic
1120965252 14:90161406-90161428 CTGAACTATACATTTTAAAATGG + Intronic
1121997382 14:98613868-98613890 CTGGCCTGTACACTTAAAAATGG - Intergenic
1122523712 14:102364477-102364499 CTGGCCCATGAACTTTAAAAGGG + Intronic
1125364640 15:38901067-38901089 CTGAAGTCTCCAGTTTAAAATGG - Intergenic
1125995246 15:44153660-44153682 CTGGACTGTACATTTTAAAATGG + Intronic
1126167002 15:45662183-45662205 CAAGGCTATCCAGTTTAAGATGG - Intronic
1128779984 15:70352942-70352964 CTGGACTGTACACTTTAAAATGG - Intergenic
1131623918 15:94097665-94097687 CTGGCCTATACATTTTTTAAAGG + Intergenic
1132899347 16:2244774-2244796 CTCTCCTATCCAGTTTGAAGCGG - Intronic
1133117629 16:3587135-3587157 CTGAACTGTCCATTTTAAAAGGG + Intronic
1133294335 16:4743545-4743567 CTGGCCTCCCCATTTAAAAAGGG + Intronic
1135245776 16:20855690-20855712 ATTGCATATCCAGTTTAAACTGG - Exonic
1137764565 16:50967958-50967980 CTGGCCTATCCAACTTCAGAAGG + Intergenic
1138604083 16:58076452-58076474 TTGGCCTATCCAGATTGCAAAGG + Intergenic
1140339307 16:74141390-74141412 CTGGACTGTACATTTTAAAAGGG + Intergenic
1140530019 16:75657534-75657556 ATGGCCTATTCATTCTAAAATGG - Intronic
1141457115 16:84150514-84150536 CTTGCCTGACCAGTTTACAAAGG + Intronic
1141993756 16:87624192-87624214 CTGGACTGTACAGTTTAAATGGG - Intronic
1145053246 17:19680662-19680684 CTGCCCTGCCCTGTTTAAAAAGG + Intronic
1145260899 17:21354033-21354055 CTGGCCTGTTCACTTTGAAATGG + Intergenic
1145969300 17:28946904-28946926 CAGTCTTAGCCAGTTTAAAAGGG + Intronic
1149017576 17:51926056-51926078 CTGAACCATCCACTTTAAAATGG + Intronic
1151137559 17:71961925-71961947 CTGGCCAATCCATTGCAAAACGG + Intergenic
1153213495 18:2794161-2794183 CTGGCCTATCCAGTTTAAAATGG - Intronic
1156949160 18:42872192-42872214 ATGGCCTAGCCAGTTTGAGAGGG - Intronic
1157844899 18:50994104-50994126 CTGTCATATCCAGTATAACAAGG + Intronic
1161538620 19:4835693-4835715 CTGGCCTATGCGAATTAAAAAGG - Intergenic
1162881120 19:13660343-13660365 CTGAACTGTCCACTTTAAAATGG + Intergenic
927107493 2:19840625-19840647 CTGGCCTAGCCAGTTCTAAAGGG + Intergenic
927335345 2:21916437-21916459 CTGCCCTGTCCAATTTAAAGAGG - Intergenic
930520928 2:52466499-52466521 CTGGAAAATCCAGTATAAAATGG - Intergenic
931252437 2:60545320-60545342 CTGGCCTGGCCAGTCGAAAATGG + Intronic
935164020 2:100554033-100554055 TTTGCCTATCCTGTGTAAAATGG - Intergenic
937834991 2:126462547-126462569 CTGGCCAATCCACTATAAATTGG + Intergenic
939610161 2:144300223-144300245 CTGACCTATACACTTAAAAATGG + Intronic
940098745 2:150008945-150008967 CTAGCATATCCAGTGAAAAATGG + Intergenic
940295187 2:152115313-152115335 CTGACCTGTTCACTTTAAAATGG + Intergenic
942084506 2:172431322-172431344 CTGGCTTTTCCATTTAAAAATGG - Intronic
946693474 2:222328267-222328289 CTGGACTATACACTTAAAAATGG - Intergenic
1169396378 20:5234123-5234145 CTGGACTATACAATTAAAAATGG + Intergenic
1169561724 20:6808742-6808764 CTGAACTATACACTTTAAAATGG - Intergenic
1170063393 20:12284575-12284597 CTGGGCTACACAGTTTCAAAGGG + Intergenic
1174285938 20:49473634-49473656 CTGAACTATACATTTTAAAACGG + Intronic
1174995695 20:55565927-55565949 CTGGACTGTCCACTTAAAAATGG - Intergenic
1177787238 21:25684467-25684489 CTGAACTATACAGTTAAAAATGG + Intronic
1177849694 21:26331863-26331885 CTGTCCTCTCAAATTTAAAAAGG - Intergenic
1179227541 21:39468342-39468364 ATGCACTATCCAGTTTAAGAAGG + Intronic
1179379501 21:40885409-40885431 CTGGCTTGTACAGTTTAAATAGG - Intergenic
1181542757 22:23582511-23582533 CAGCACTTTCCAGTTTAAAAAGG - Intergenic
1183826633 22:40393413-40393435 CAGGCCTATACATTTTTAAATGG + Intronic
953787581 3:45922511-45922533 CTGCCCTATCCTGTTCAAGAGGG + Intronic
954990180 3:54833877-54833899 CTGGCCAAGCCAGTTCAAATTGG + Intronic
956585933 3:70864964-70864986 CTGTCCTGTCCTGTCTAAAATGG - Intergenic
959780223 3:110223124-110223146 CTGGGGTCTCCAGTTTAAGATGG - Intergenic
960413483 3:117356519-117356541 CTGCCTTATCCATTTGAAAAGGG - Intergenic
962659838 3:137590202-137590224 CTGAACTATACAGTTAAAAATGG - Intergenic
963699577 3:148607634-148607656 CTGAACTATACACTTTAAAAGGG - Intergenic
967340403 3:188390982-188391004 ATGCCCGATACAGTTTAAAAGGG - Intronic
967760182 3:193215270-193215292 CTGACCTCTACAATTTAAAAAGG - Intergenic
970524004 4:16913182-16913204 CTGGCCTATCAAGCTATAAATGG + Intergenic
970778231 4:19703233-19703255 CTGGTCTATCCAGTGGAAGAGGG + Intergenic
970992808 4:22232768-22232790 CAGGCCTATAAAGTTTACAAGGG + Intergenic
973825395 4:54700221-54700243 TTGGCCTATCCATTTGAAGATGG + Intronic
973864448 4:55097865-55097887 CTGGACTATCCATGTTAAATTGG - Intronic
973962680 4:56127460-56127482 CTGAGTTTTCCAGTTTAAAAAGG + Intergenic
975123747 4:70758205-70758227 CTAACCTATCCTGTTAAAAAGGG - Intronic
976347654 4:84023783-84023805 CTGAACTATACACTTTAAAATGG - Intergenic
978591338 4:110327996-110328018 CAGTCCTTTCCAGCTTAAAAGGG - Intergenic
980098917 4:128521910-128521932 CTAGATTATCTAGTTTAAAAAGG + Intergenic
981127914 4:141128072-141128094 CTGGCCTCTTCAGTATGAAAGGG + Intronic
981464482 4:145052426-145052448 CTAGCCTAACCAGTTTACAGAGG + Intronic
981610954 4:146593232-146593254 CTGACCTGTACAGTTAAAAATGG + Intergenic
983727068 4:170941541-170941563 CTAGACTAACCAGTTTAGAATGG + Intergenic
984159850 4:176238488-176238510 CTGGCCTATAAAGTTGAAAAAGG + Intronic
984350907 4:178591792-178591814 CTTGTCTATCTAGTTGAAAATGG - Intergenic
984730064 4:183059869-183059891 CTGGACTGTACATTTTAAAATGG - Intergenic
992836464 5:80646459-80646481 CTGAACTATACACTTTAAAAGGG - Intronic
993099796 5:83523695-83523717 CTTCCCAATGCAGTTTAAAAAGG + Intronic
993964515 5:94345025-94345047 CTGAACTATACAGTTTAAAATGG + Intronic
996622441 5:125524265-125524287 CTGGAATTTCTAGTTTAAAAAGG + Intergenic
1000226809 5:159269479-159269501 CATTCATATCCAGTTTAAAAGGG + Intronic
1002772950 6:304724-304746 CTGACCTATACACTTTAAAATGG - Intronic
1003641293 6:7877744-7877766 CTGGCTTATGTAGTTGAAAAGGG + Intronic
1004860823 6:19803104-19803126 CTGGCCTATTTTGTGTAAAATGG - Intergenic
1006555927 6:34866608-34866630 CTGAACTATCCACTTAAAAACGG - Intronic
1006974475 6:38085811-38085833 TAGGACTATGCAGTTTAAAAAGG + Intronic
1010184976 6:73133663-73133685 ATAGCCTATCCAATTAAAAATGG - Intronic
1010786213 6:80004403-80004425 CTGGTCTTTCCAGTTTAACCAGG - Intronic
1011380861 6:86740750-86740772 CTGGCCCTTCCAGGATAAAAGGG + Intergenic
1014053804 6:116989394-116989416 CTGTCCTATGCATTGTAAAATGG - Intergenic
1017199426 6:151736140-151736162 TTGGCCTTCCAAGTTTAAAAAGG - Intronic
1022722433 7:32953282-32953304 CGGGCCTATCCAGATTCAACAGG + Intergenic
1022766239 7:33415610-33415632 GTGGACTTTCCAGTTTAGAAGGG + Intronic
1023817160 7:43959890-43959912 CTGGCCTATCAAGCTGAAACAGG + Intergenic
1025859958 7:65317476-65317498 CTGGCCTTTAAAGTTTAAAGAGG - Intergenic
1027491613 7:78834225-78834247 CTGACCTGTACACTTTAAAAGGG - Intronic
1030230029 7:107198099-107198121 CTGGACTATCCTGATTATAAGGG + Intronic
1033373257 7:140731310-140731332 CTGGCCCAGGCAGTTTCAAAAGG + Intronic
1033472015 7:141658729-141658751 CTGGGCTATACAGTTTCGAAGGG + Exonic
1034965677 7:155389197-155389219 CTGTCCTCTCCACTGTAAAATGG - Intronic
1035695167 8:1590714-1590736 CTGTCCTATTCACTTGAAAATGG + Intronic
1037202688 8:16276938-16276960 CTGACCTCTTCATTTTAAAAAGG - Intronic
1037269420 8:17110288-17110310 CTGAATTATTCAGTTTAAAACGG - Intronic
1037729348 8:21510728-21510750 CTGGTCTCTCCATTTTAAATAGG + Intergenic
1038154475 8:24975659-24975681 CTGAACTATACACTTTAAAATGG - Intergenic
1038298444 8:26318884-26318906 CTGAACTATACACTTTAAAATGG - Intronic
1038688277 8:29738332-29738354 CTGGCATTTCCAGTTGAAAAGGG - Intergenic
1039133499 8:34294504-34294526 CTGGCCTGTCCAGTGGAACATGG + Intergenic
1040424068 8:47266770-47266792 CTGGATTTTCCACTTTAAAAGGG - Intronic
1045549241 8:103155482-103155504 CTGGCCGATACAGGGTAAAAAGG - Intronic
1050298033 9:4226898-4226920 CTGACCCATCCAGTTTTAAAGGG + Intronic
1050697545 9:8295675-8295697 CTAGCTTAACCAGTTTCAAAGGG + Intergenic
1050910928 9:11069867-11069889 CTGGCCTAACAAGTTTGAAATGG - Intergenic
1051538108 9:18182410-18182432 GTGGTCTATACAGTTTAAGAAGG + Intergenic
1055094443 9:72396993-72397015 CTGGCCTATCCTCTTAGAAATGG + Intergenic
1058193452 9:101945914-101945936 CTGGGTAATCCAGTTTGAAAAGG + Intergenic
1058352204 9:104039155-104039177 CTTGGCAATCCAATTTAAAATGG + Intergenic
1059368323 9:113804812-113804834 CTGACTTATACACTTTAAAAAGG + Intergenic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1061879195 9:133560275-133560297 CTGCACTGTCCAGTTTAAAAAGG + Intronic
1185560130 X:1054369-1054391 CTGACTCATTCAGTTTAAAACGG + Intergenic
1188222645 X:27559410-27559432 CTGGCCTTTCCAGGTTAGAAGGG + Intergenic
1188310665 X:28612604-28612626 CTTGCCTAGCCAATTTAAACAGG - Intronic
1188961184 X:36493957-36493979 CTGACCTGTACACTTTAAAATGG - Intergenic
1190473546 X:50806464-50806486 TTGCCCTATCCAGTGTAAATAGG - Intronic
1193158282 X:78198418-78198440 CTGGTCTAGACAGTTTAAACTGG + Intergenic
1193659841 X:84243984-84244006 CTGGCCTAGAAAGTTTAGAATGG + Intergenic
1193828997 X:86264577-86264599 CTGCCCAATCCAGGTTAAATGGG + Intronic
1194429809 X:93788043-93788065 CTGAACTATACACTTTAAAATGG - Intergenic
1196791914 X:119471662-119471684 CTGAATTATCCACTTTAAAATGG + Intergenic
1197312244 X:124918890-124918912 CTGGCTTACCCAGTCTAAATGGG - Intronic
1198324794 X:135558711-135558733 CTGGACTGTACAGTTAAAAATGG + Intronic
1198541306 X:137643124-137643146 ATGGCCTTTACATTTTAAAATGG - Intergenic
1199103688 X:143837425-143837447 CTTGCCTAGCCAGTTCCAAAAGG - Intergenic
1199889472 X:152061334-152061356 CTGGGTTATACACTTTAAAATGG + Intergenic