ID: 1153213669

View in Genome Browser
Species Human (GRCh38)
Location 18:2796274-2796296
Sequence CTGAGAATGCCTATTACTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153213669 Original CRISPR CTGAGAATGCCTATTACTTC TGG (reversed) Intronic
904264687 1:29311465-29311487 CTGAGATGGTCTATGACTTCTGG + Exonic
909738873 1:79003049-79003071 CAGAGGATGCCTATTTCTTGAGG - Intronic
912705000 1:111905005-111905027 CTGAGAATGCCATGGACTTCCGG - Intronic
920853318 1:209643960-209643982 CTGAGAGTACCTTTAACTTCTGG - Intronic
922611757 1:226935563-226935585 CTGAGAATGACTATTTCATTGGG + Intronic
923333803 1:232950113-232950135 CTGACACTCCCTATTACTGCAGG + Intergenic
1066318556 10:34275392-34275414 TTGAGAATGCACATTAGTTCAGG - Intronic
1066348454 10:34613098-34613120 CTGAGCATGCCTTTAAATTCAGG - Intronic
1068213146 10:53948520-53948542 CTAAGAATGCTTTTTACCTCTGG - Intronic
1068562425 10:58530306-58530328 CTGAGGATGACTACTACTTCTGG + Intronic
1071485810 10:86102029-86102051 CTGAGAACGAATATTTCTTCTGG + Intronic
1071768656 10:88699635-88699657 ATGAGAAAGCCTATTTCTTTTGG - Intergenic
1072990611 10:100189170-100189192 CTTAAAATGCCTATTACTTGAGG + Exonic
1074326747 10:112457931-112457953 CTAAGAATGTCTATTAGTTTGGG + Intronic
1077622377 11:3738543-3738565 CTGAGCAAGCAGATTACTTCAGG + Intronic
1077638270 11:3858262-3858284 GCTAGAATGCCTTTTACTTCAGG - Intronic
1080288094 11:30640036-30640058 CTGAGAATGCCTAACACTCTGGG - Intergenic
1082570550 11:54732712-54732734 CTGAGAATGTACATTACCTCAGG - Intergenic
1092726650 12:11492954-11492976 CGTGGATTGCCTATTACTTCCGG - Intronic
1096222363 12:49839092-49839114 CTGAGAATGCCACTTACCTCTGG + Intronic
1097364361 12:58695154-58695176 CTGAGAATGTACATCACTTCAGG + Intronic
1102757195 12:115351410-115351432 CTGAGATTGTCTATTACATTTGG + Intergenic
1104601871 12:130160559-130160581 CTGAACCTGCCTATTAATTCTGG + Intergenic
1105419308 13:20238609-20238631 CTGAGAATGCCTGTGACCACTGG - Intergenic
1106697853 13:32197311-32197333 AAGTGAATGCCTATTTCTTCAGG + Intronic
1108791516 13:53973897-53973919 CTGAGAATGTACATCACTTCAGG - Intergenic
1109930625 13:69212478-69212500 CTGAGAATCTTTTTTACTTCTGG + Intergenic
1110680583 13:78307394-78307416 CAGGGAATACCTATTAGTTCTGG + Intergenic
1111325632 13:86693366-86693388 CTGAGAAAGCCTATTCCATGAGG - Intergenic
1112343629 13:98572628-98572650 CTGAGAATGCCCCTTGCATCAGG - Intronic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1114934756 14:27519966-27519988 CTGTTAATGACTATTACCTCTGG - Intergenic
1115302105 14:31895855-31895877 CCCAGAATTCCTTTTACTTCTGG + Intergenic
1115517627 14:34201884-34201906 CTGAGAATCCCTCTGACTACTGG + Intronic
1116536678 14:46040482-46040504 CAGAGAATCCCTGTTACTTAAGG - Intergenic
1118426085 14:65664380-65664402 GTGAGAATGCTTATTGCTTTAGG + Intronic
1120201063 14:81538703-81538725 CTGAGAATGTCTGTAACCTCAGG - Intergenic
1127355084 15:58190594-58190616 CTGAGACTGCCTTTTAACTCTGG + Intronic
1129161356 15:73749747-73749769 ATGAGAATGACTGTTGCTTCAGG - Intronic
1132560640 16:591969-591991 CTGAGCATGCCTCTTAATTTAGG + Intronic
1133361673 16:5178917-5178939 CTGAGAATGTGTATCACCTCAGG - Intergenic
1137409777 16:48218315-48218337 CCAAGATTGCCTACTACTTCTGG - Intronic
1138926138 16:61593399-61593421 CTGAGCAGGCCGATTACTTGAGG + Intergenic
1139727270 16:68911376-68911398 CTAAGAATGCTTATTGCTACTGG - Intronic
1153213669 18:2796274-2796296 CTGAGAATGCCTATTACTTCTGG - Intronic
1158011289 18:52730866-52730888 CTGAAAATGCCTAATTCTTGGGG - Intronic
925082868 2:1083555-1083577 CCGAAAATGCCTATGACATCCGG + Exonic
925316233 2:2926725-2926747 TTCAGATTGCCTATTTCTTCTGG + Intergenic
925456140 2:4018176-4018198 CTGAGGATGTATATAACTTCAGG - Intergenic
930057450 2:47263027-47263049 ATGAGAATGGCAGTTACTTCAGG + Intergenic
937688734 2:124728640-124728662 CTATGAATAACTATTACTTCAGG - Intronic
942125921 2:172825024-172825046 TTGAGCATGCCTATTGCTTCTGG + Intronic
943190313 2:184669220-184669242 CTGAGAATACATATTTTTTCTGG + Intronic
945705136 2:213221195-213221217 TTGAGAATGACTGTTACTTTGGG + Intergenic
948281287 2:236749719-236749741 CTGGGAATTCCTTTTGCTTCCGG - Intergenic
948302887 2:236921452-236921474 CTTAGATTGCCTTTTTCTTCTGG + Intergenic
1170801147 20:19591259-19591281 CTGAGAATGAATCTGACTTCAGG - Intronic
1172498276 20:35405035-35405057 CTAAGAATGTCTCTTACTTGTGG + Intronic
1174754902 20:53148549-53148571 CTGAGTTTGCCTATTAAATCAGG + Intronic
1175644011 20:60656145-60656167 CTGGGAAGGCACATTACTTCAGG - Intergenic
951259157 3:20485977-20485999 CTTAAAATTCCTATTATTTCAGG + Intergenic
952503075 3:33982259-33982281 CTGAGAATGTCTTTCATTTCTGG + Intergenic
953193814 3:40713525-40713547 CTGAGAGTGCCAAGAACTTCAGG - Intergenic
953582532 3:44169994-44170016 CTGAGAATGCCTATGTCTCAAGG + Intergenic
959233405 3:103688486-103688508 ATGAGAATTTCTCTTACTTCAGG - Intergenic
967326355 3:188244191-188244213 CTGAGAATGGCTTTTAATTTGGG + Intronic
967605655 3:191442574-191442596 CTGAGAAATACTATCACTTCAGG + Intergenic
969065417 4:4476009-4476031 AAGAGAATGCCTCTTACTTGAGG + Intronic
970964839 4:21916391-21916413 CTGAGATTGCTTATGACATCAGG - Intronic
972314235 4:37911078-37911100 ATGAATATTCCTATTACTTCTGG - Intronic
973812849 4:54589104-54589126 CTTAGGATTCCAATTACTTCTGG - Intergenic
976560254 4:86492813-86492835 CTGACAATACCTATTACTTCTGG + Intronic
976568585 4:86582041-86582063 CTGAGAATTCCTATTACACTTGG - Intronic
977474676 4:97490474-97490496 CTGAGAATGGCTATCATTTTTGG - Intronic
984801114 4:183718040-183718062 ATAAAAATGCCTAGTACTTCAGG - Intergenic
991986766 5:72296325-72296347 CTAAAAATGCCTAGCACTTCTGG + Intronic
993534144 5:89060666-89060688 CTGAGAAAGCCTAATATTTAAGG - Intergenic
994670565 5:102756824-102756846 ATGAAAATGCCTATTAAGTCAGG - Intronic
997620993 5:135295078-135295100 CTGAAAAGGCCCATCACTTCTGG - Intronic
998528544 5:142864173-142864195 CTGAGGAAGCCCAGTACTTCAGG + Intronic
998931820 5:147189713-147189735 CTGATATTGCCTATTGCTCCTGG + Intergenic
999457551 5:151730179-151730201 CTGAGGATGCATGTCACTTCAGG - Intergenic
1001734420 5:173987387-173987409 CTGTCACTGCCTATTACTTTGGG + Intronic
1002984939 6:2180336-2180358 CTGAGAAAGCAGATTAGTTCTGG - Intronic
1004050857 6:12077518-12077540 CTGAGAAGGCTCCTTACTTCAGG - Intronic
1008891486 6:56497507-56497529 TTAAAACTGCCTATTACTTCAGG - Exonic
1010976602 6:82322361-82322383 TTGAGAATGCCTATTAGTGATGG + Intergenic
1013876368 6:114834800-114834822 ATGAGAATGCTTATTAATTTTGG + Intergenic
1015377251 6:132525424-132525446 CTGAGAAAGCCCAATATTTCAGG + Intergenic
1017314306 6:153012802-153012824 CTGCAAATGCCTTTTAGTTCTGG + Intronic
1018327209 6:162684642-162684664 CTGAGAATGCATAATACATGGGG + Intronic
1018773469 6:166992838-166992860 CTGATAATGCAAATAACTTCAGG + Intergenic
1021126340 7:16854363-16854385 CTGAGAATGACTGTTGCTTTTGG + Intergenic
1022445505 7:30467276-30467298 GTGAGAATGAAAATTACTTCTGG + Intronic
1022879283 7:34569054-34569076 GTCAAAATCCCTATTACTTCAGG + Intergenic
1023522966 7:41067315-41067337 CTGAGAATCCCTGTACCTTCTGG - Intergenic
1024508901 7:50187037-50187059 CTTAGAATGCATATTAATTGTGG - Intergenic
1026280052 7:68914252-68914274 CTGAAAATGCATATTCCTTAAGG + Intergenic
1026500971 7:70943147-70943169 CTGAGAATTCCTATAATTCCCGG + Intergenic
1027337368 7:77166153-77166175 CTGACAATTCCTGTAACTTCTGG - Intronic
1028280671 7:88923698-88923720 TTGATAATACCTATTACCTCAGG - Intronic
1029778430 7:102704968-102704990 CTGACAATTCCTGTAACTTCTGG + Intergenic
1031401355 7:121329134-121329156 CTGAGAGTCCCTATCACTGCTGG + Exonic
1031659882 7:124409608-124409630 CTGAAAGTGCCCATTCCTTCAGG + Intergenic
1040975682 8:53191700-53191722 CTGAGAGTTTCTATCACTTCAGG + Intergenic
1041042729 8:53863370-53863392 CTGAGAATGCTTATTGCATCTGG - Intronic
1041327785 8:56687557-56687579 CTGAGAAAGATTATTACTACTGG + Intergenic
1048414433 8:134210478-134210500 ATGAGAGTTCCTATTGCTTCAGG + Intergenic
1052257530 9:26475929-26475951 CTGAGCATGCTTCTGACTTCTGG - Intergenic
1056305510 9:85286835-85286857 CAGAGAATGCATATTTCATCTGG - Intergenic
1056340741 9:85629234-85629256 GTAAGAATGTCAATTACTTCAGG + Intronic
1056525423 9:87439075-87439097 CTGGGAATGCCTCTTTCTTTGGG + Intergenic
1057746343 9:97754842-97754864 CTGAGAGTGCCCATTGCTACTGG + Intergenic
1059091192 9:111360300-111360322 TTGAGAATGGCTATTGCTTGGGG - Intergenic
1059580945 9:115547620-115547642 CTGAGAATGTATATCACCTCAGG - Intergenic
1061595191 9:131624405-131624427 CTGAAAATCCCTATTAATTTAGG - Intronic
1189390425 X:40571648-40571670 CTGAGAATGCCTAGTCCTCTGGG + Intergenic
1190665601 X:52693646-52693668 CTGTGAATTCCAATTACTGCGGG - Intronic
1190673821 X:52764772-52764794 CTGTGAATTCCAATTACTGCGGG + Intronic
1195258362 X:103110063-103110085 CTGAGAATGTATGTCACTTCAGG - Intergenic
1196004683 X:110822807-110822829 CTAAAAATGCTTATTACTACTGG + Intergenic
1201860402 Y:18591566-18591588 CTGAGAATGCATGTCACCTCAGG + Intergenic
1201872921 Y:18728815-18728837 CTGAGAATGCATGTCACCTCAGG - Intergenic