ID: 1153215671

View in Genome Browser
Species Human (GRCh38)
Location 18:2818403-2818425
Sequence CTCAGAAAACTAGACATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153215668_1153215671 3 Left 1153215668 18:2818377-2818399 CCCAACATTCTTTCATGATAAAA 0: 2
1: 8
2: 40
3: 120
4: 604
Right 1153215671 18:2818403-2818425 CTCAGAAAACTAGACATGGAAGG No data
1153215669_1153215671 2 Left 1153215669 18:2818378-2818400 CCAACATTCTTTCATGATAAAAA 0: 8
1: 76
2: 389
3: 828
4: 1765
Right 1153215671 18:2818403-2818425 CTCAGAAAACTAGACATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153215671 Original CRISPR CTCAGAAAACTAGACATGGA AGG Intergenic
No off target data available for this crispr