ID: 1153225999

View in Genome Browser
Species Human (GRCh38)
Location 18:2900442-2900464
Sequence TGCAATCCCAGTACATTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366890
Summary {0: 1, 1: 14, 2: 882, 3: 25831, 4: 340162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153225999_1153226005 20 Left 1153225999 18:2900442-2900464 CCTCCTAATGTACTGGGATTGCA 0: 1
1: 14
2: 882
3: 25831
4: 340162
Right 1153226005 18:2900485-2900507 GCTCAAAAGCAGTGTTGAGATGG 0: 1
1: 0
2: 10
3: 65
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153225999 Original CRISPR TGCAATCCCAGTACATTAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr