ID: 1153232026

View in Genome Browser
Species Human (GRCh38)
Location 18:2947373-2947395
Sequence TTGTCCTTCTAGAGGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 222}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153232026_1153232030 21 Left 1153232026 18:2947373-2947395 CCATCCATCCTCTAGAAGGACAA 0: 1
1: 0
2: 1
3: 15
4: 222
Right 1153232030 18:2947417-2947439 TAAGCCCAACGCCCATCTTTAGG 0: 1
1: 0
2: 0
3: 3
4: 73
1153232026_1153232036 30 Left 1153232026 18:2947373-2947395 CCATCCATCCTCTAGAAGGACAA 0: 1
1: 0
2: 1
3: 15
4: 222
Right 1153232036 18:2947426-2947448 CGCCCATCTTTAGGAAGGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 82
1153232026_1153232034 26 Left 1153232026 18:2947373-2947395 CCATCCATCCTCTAGAAGGACAA 0: 1
1: 0
2: 1
3: 15
4: 222
Right 1153232034 18:2947422-2947444 CCAACGCCCATCTTTAGGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 87
1153232026_1153232035 29 Left 1153232026 18:2947373-2947395 CCATCCATCCTCTAGAAGGACAA 0: 1
1: 0
2: 1
3: 15
4: 222
Right 1153232035 18:2947425-2947447 ACGCCCATCTTTAGGAAGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 59
1153232026_1153232032 25 Left 1153232026 18:2947373-2947395 CCATCCATCCTCTAGAAGGACAA 0: 1
1: 0
2: 1
3: 15
4: 222
Right 1153232032 18:2947421-2947443 CCCAACGCCCATCTTTAGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153232026 Original CRISPR TTGTCCTTCTAGAGGATGGA TGG (reversed) Intronic
900510766 1:3059813-3059835 TTTTCATTTTAGAGGATGGAAGG - Intergenic
902328931 1:15720987-15721009 TTGCCCTGCTAGGGTATGGAGGG + Intronic
902408936 1:16201805-16201827 TTGTCCTCCTGGGGGCTGGAGGG + Exonic
902538607 1:17136541-17136563 TTGCCCTGGGAGAGGATGGAGGG - Intergenic
903805246 1:26000586-26000608 TGTTCCTTCTGGAGGATGGGTGG - Intergenic
904356482 1:29943393-29943415 TTGTCCCCATAGAGGATGGCGGG - Intergenic
904942481 1:34174709-34174731 TTGCCATTCTAGAGGTTAGAAGG - Intronic
906079343 1:43073914-43073936 TTGTCCTTTTAGAGTCGGGACGG + Intergenic
907240355 1:53077670-53077692 TTGTTGTTCTGGGGGATGGAAGG - Exonic
907973407 1:59407211-59407233 TTGTCCTTTTAGCTGATGGGTGG + Intronic
909060675 1:70875625-70875647 GTGTCCTACTTGAGGCTGGAGGG - Intronic
909209977 1:72810700-72810722 ATGTCCTTCTAGAAGACTGAAGG + Intergenic
910692473 1:89978918-89978940 TAGTCATTCTATTGGATGGATGG + Intergenic
911392122 1:97258414-97258436 TTGTCCCCCTGAAGGATGGAAGG - Intronic
911650356 1:100381065-100381087 ATGAGCTTCTAGAGGGTGGAAGG + Intronic
912759717 1:112356352-112356374 TTTTTCTTGTAGAGGAAGGAGGG - Intergenic
916339745 1:163718682-163718704 ATGGACTCCTAGAGGATGGAGGG + Intergenic
916482094 1:165223470-165223492 TTCTCCTACTAGAGGTAGGAAGG - Intronic
916571962 1:166035916-166035938 TTTTCCTTTAAGAGGATTGAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919326341 1:196111530-196111552 TTGACCATCTATAGGATGCAAGG - Intergenic
920770016 1:208875135-208875157 TTTTCCCCCTAGAGGCTGGAGGG - Intergenic
921345282 1:214177333-214177355 ATGTCCTAGCAGAGGATGGATGG - Intergenic
921421072 1:214948876-214948898 TTGTCCTTGTAGTGGAAGTAGGG + Intergenic
1063020795 10:2125700-2125722 TTGTTCCTCTAGAGGCTGTAGGG + Intergenic
1064705699 10:18070217-18070239 TTGTCCTTCAAGAGAAATGACGG - Intergenic
1065040996 10:21696047-21696069 TTGTGCCTCTAATGGATGGATGG - Intronic
1065567044 10:27022253-27022275 GGGGCCTCCTAGAGGATGGAGGG + Intronic
1067983086 10:51109640-51109662 GTGTTCTTCTAAAAGATGGAAGG - Intronic
1069890049 10:71646943-71646965 TTGCCCTTCTCAAGGATGGCTGG - Intronic
1071021402 10:81061208-81061230 TGGTCCTTCTTGGGGAGGGAAGG + Intergenic
1071255661 10:83869632-83869654 GTGTGTCTCTAGAGGATGGAGGG - Intergenic
1073515012 10:104068530-104068552 TTGGCCTTCTAGAAGCTTGAGGG - Intronic
1075942778 10:126405677-126405699 TTGTGCTGCAAGAGGAGGGATGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080604001 11:33848949-33848971 ATGTCGTTTTAGAGGAGGGAGGG - Intergenic
1081431925 11:42985858-42985880 GTGGACTACTAGAGGATGGAGGG + Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082778611 11:57268592-57268614 GTGACCTTTCAGAGGATGGAGGG + Intergenic
1084344566 11:68537019-68537041 TTTTCCTTGTTGAGGAAGGATGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087524702 11:99295517-99295539 ATGTCCTTCTAGAAGACTGAAGG + Intronic
1088086518 11:105987262-105987284 TTTTCCTTCCAGGAGATGGAAGG + Intergenic
1088305202 11:108400207-108400229 TTGTGCTTCTTCAGGATGGATGG + Intronic
1089135110 11:116242704-116242726 TCCTCCTTTTGGAGGATGGATGG - Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1092570834 12:9719621-9719643 ATGGCCTTCTGGAGGCTGGAGGG + Intronic
1092749321 12:11703730-11703752 GTTTCCTTCTTGGGGATGGAGGG + Intronic
1094025344 12:25955994-25956016 TGTTCCTTCTGGAGGATCGAGGG - Intergenic
1096204751 12:49711772-49711794 TGTTCCTTATAGAGGATTGAGGG - Intronic
1096357752 12:50956465-50956487 TTTTCCTGCTACAGGATGGAGGG + Intronic
1097115866 12:56696734-56696756 GTGTCCTTCTGGAGGTTGCAGGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098655970 12:73029571-73029593 TTGTTCTTCCAAAGGATTGAAGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101251752 12:102943867-102943889 GAGTCCTTCTTGAGGTTGGAGGG + Intronic
1104133622 12:125917492-125917514 TCATGCTTCTGGAGGATGGAGGG - Intergenic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1105813758 13:24015658-24015680 CTGACCTTCTAGGGGATGGCAGG - Intronic
1108590279 13:51906775-51906797 TTGTACTTCTAGAGGAGAGTTGG - Intergenic
1109860162 13:68187779-68187801 ATGTCATTCTAGAGGAGAGAAGG + Intergenic
1110149594 13:72234770-72234792 AGGTCCTACTTGAGGATGGAGGG - Intergenic
1110708537 13:78624353-78624375 TGGTACTTTTAGAAGATGGAGGG - Intronic
1111184327 13:84711633-84711655 TTGTTCTTTTAGAGGATAAATGG + Intergenic
1113499332 13:110760784-110760806 CTGTACTTCCAGAGGATTGAGGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1118291847 14:64533777-64533799 TTGTGGTATTAGAGGATGGAAGG - Intergenic
1119675770 14:76552399-76552421 TTGTCACACTGGAGGATGGAGGG - Intergenic
1124923096 15:34045527-34045549 TTGTCCTTGAAAAGGAAGGAGGG + Intronic
1125057254 15:35375872-35375894 TTGTCCTTTTAGAGGAGAGGTGG - Intronic
1125112352 15:36047833-36047855 TTGTCCTTCTGGTGGATTCATGG - Intergenic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1130398467 15:83526652-83526674 TGGGCCTTCCAGAGGGTGGAGGG + Intronic
1131637258 15:94249345-94249367 TGGTCCTTCTATAGGATCTATGG + Intronic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1134402044 16:13919441-13919463 GTGTCCCTCTAGTGGAAGGAGGG + Intergenic
1137339037 16:47581299-47581321 AACTCCCTCTAGAGGATGGATGG + Intronic
1142313140 16:89325845-89325867 TTGGCCTCCTAGAGGAAGGAGGG + Intronic
1143058973 17:4184297-4184319 TTGTCCTTCTGGAGGGAGGTTGG - Intronic
1143343601 17:6233119-6233141 TTGTCCTTCTGTAGGAATGAAGG + Intergenic
1143813143 17:9488693-9488715 TCTTCCTTCTGGAGGATGTAGGG - Intronic
1145233470 17:21191854-21191876 TTTCACTTCTAGAGGATGCACGG - Exonic
1146451092 17:32974634-32974656 TTCGCCTTCCAGAGGATGCATGG - Intronic
1150023988 17:61652492-61652514 TTGTGCTTCCAGGTGATGGAGGG + Intergenic
1151320425 17:73349295-73349317 GTGTTCATCTAGAGGATGGAGGG - Intronic
1151483849 17:74386475-74386497 TGGTCGTTGTAGAGGATGGCGGG + Intergenic
1151545159 17:74788392-74788414 CTGTCCTTCCAGAGGCTGGGGGG + Intronic
1152501298 17:80711296-80711318 TTGACCCTCCAGAGGATGGAAGG + Intronic
1152780952 17:82227234-82227256 TTGTCCTTCAGGAGGCAGGAGGG + Intergenic
1153232026 18:2947373-2947395 TTGTCCTTCTAGAGGATGGATGG - Intronic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1157151231 18:45220804-45220826 TTGTGGTTCTCGAGGCTGGAAGG + Intronic
1159404703 18:67985138-67985160 TGGTCCTTTTGGAGGGTGGAGGG - Intergenic
1160000518 18:75016117-75016139 TTGTCCTTATATGGGATTGACGG - Intronic
1160172186 18:76564039-76564061 TTTCCCTTCTAGAGGATGAATGG + Intergenic
1161880558 19:6948421-6948443 AGGTCCTTCTTGAGGGTGGAAGG - Intergenic
1162066040 19:8126095-8126117 TTGTCCTTGAGGAGGAAGGAAGG + Intronic
1163629159 19:18408278-18408300 TTGTCCTACCTGAGGGTGGAGGG - Intergenic
1167461654 19:49627884-49627906 TTGTCATTCTAGAGCCTGGATGG + Intergenic
1167719946 19:51172417-51172439 GTGCCCTGCTAGAGGCTGGAGGG - Intergenic
926124315 2:10262601-10262623 TTTTCCTTCTAGTGGCTGCAAGG - Intergenic
926705366 2:15833814-15833836 GTGTCCTTCCAAAGCATGGAAGG - Intergenic
928478488 2:31655742-31655764 TTATTCTTCTAAAGCATGGAGGG - Intergenic
931371161 2:61664135-61664157 TTAACCTTCTGGAGGATGGTGGG + Intergenic
937092928 2:119218446-119218468 TTGGCCTTCAAGGGGAGGGAAGG - Intergenic
937349357 2:121150631-121150653 TTTTCCTTCCAGAGTATGTAGGG - Intergenic
938982974 2:136544262-136544284 AAGTCCATCTAGAGTATGGAGGG - Intergenic
941063804 2:160878287-160878309 TGGTCCTTCTAGAGGGTCTAGGG + Intergenic
942629890 2:177944221-177944243 GTCTCTTTCTAGAGGATGGAAGG - Intronic
944752313 2:202722660-202722682 GGGGCCTTCTAGAGGGTGGAGGG + Intronic
945367777 2:208977797-208977819 TTGTCTTGCAAGAGGATGGTTGG - Intergenic
945982803 2:216327748-216327770 TTGTCCTTGTTGAGAATGGCAGG + Intronic
946082154 2:217130379-217130401 TTCTCCTCCTGGAGGACGGAGGG + Intergenic
946830970 2:223727814-223727836 TTATCCTTCTAGAGAAGGAAAGG - Intergenic
947136459 2:226981040-226981062 TTGGCCTTCCTGAGGCTGGATGG + Intronic
948439952 2:237980334-237980356 TTTCCCTTCTGGAGGCTGGAAGG + Intronic
1170206086 20:13800031-13800053 TTTTCCTTGTAGGGGTTGGAGGG + Intronic
1172487565 20:35307514-35307536 TTGGACCTCTAGAGGAGGGAGGG + Intronic
1173401119 20:42726753-42726775 GTGTGCATCTAGAGAATGGAAGG - Intronic
1174184597 20:48697777-48697799 TTCCCCTTCTGGAGGATGGGAGG + Intronic
1175479888 20:59303233-59303255 GTGTCCACCTAGAGGATGGGAGG + Intronic
1176990598 21:15491568-15491590 TTGTCCTTCTAGGGTCTGCATGG - Intergenic
1177340323 21:19790662-19790684 TTGTCACACTAGAGAATGGAAGG - Intergenic
1177529956 21:22345894-22345916 TTGTCTTTCCAGGGGAAGGAGGG - Intergenic
1182481382 22:30611199-30611221 TTGTCCATCTATAGAATGAAGGG + Intronic
1182751030 22:32642330-32642352 TTGCCCTTCTAGAAAATGGTTGG - Intronic
1183460890 22:37949800-37949822 TTGACCTTGTAGAGGCTGGATGG - Intronic
949512702 3:4780787-4780809 TTGTCATTCTTGAGCAGGGATGG + Intronic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
952215225 3:31271679-31271701 GTATCCCTCTAAAGGATGGAGGG + Intergenic
952580034 3:34822814-34822836 TTGTCCTTCGATGGCATGGATGG + Intergenic
953297975 3:41740411-41740433 TAATCCTTTTAGAGGATGAATGG - Intronic
953713284 3:45293436-45293458 TTGTCCTTATATAAGATGTATGG - Intergenic
954492171 3:50916426-50916448 TTGGCCATGTAGAGAATGGAAGG - Intronic
954686883 3:52375940-52375962 GAGTCCATCTAGAGGATGGAGGG - Exonic
957264466 3:77944483-77944505 GAGGTCTTCTAGAGGATGGAAGG + Intergenic
960306338 3:116066169-116066191 TTGTCCTCACAGAGTATGGAAGG + Intronic
960953338 3:123013725-123013747 GTGTGCTTCCAGAGGCTGGATGG - Intronic
962275699 3:134011781-134011803 TTGTCCTTTTAGAGGCTGGAGGG + Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963664150 3:148160985-148161007 TTTTCCTGCTGGAGGTTGGAGGG - Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967842004 3:194013236-194013258 TTCTACTTGGAGAGGATGGAGGG - Intergenic
970180512 4:13387082-13387104 GTGGCCTACAAGAGGATGGAGGG + Intronic
970482863 4:16495426-16495448 TTTTTCTTATGGAGGATGGAGGG + Intergenic
971420700 4:26471668-26471690 TTCTTCCTCTTGAGGATGGAAGG + Intergenic
974079694 4:57199361-57199383 TTGTCCTTCTAGTGGTTAGTAGG + Intergenic
977103804 4:92853829-92853851 GTGGACTTCTAGAGGTTGGAGGG + Intronic
977563363 4:98556204-98556226 GTATCCTTCTACAGGAAGGATGG - Intronic
979484506 4:121255198-121255220 TTGTCCCTCTAGAAGATCCAAGG + Intergenic
980531691 4:134064753-134064775 TGGGCCTACTAGAGGGTGGAGGG - Intergenic
986071060 5:4283749-4283771 TTGTCCTTCTAAAGAAGGCAAGG + Intergenic
986314628 5:6578295-6578317 TGTTCATTTTAGAGGATGGATGG - Intergenic
986953681 5:13123685-13123707 TTTTCCTTGTAGAGGAACGATGG + Intergenic
987594622 5:19981256-19981278 TTTTCCTACAAGAGTATGGATGG - Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990082002 5:51928480-51928502 ATGCCCTTCTAGAAGATCGAAGG - Intergenic
990082887 5:51938718-51938740 GGGGCCTTTTAGAGGATGGAGGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990663343 5:58043534-58043556 GTATCCATCTTGAGGATGGAAGG - Intergenic
991537846 5:67692620-67692642 TTGTGCATCTAGATGATGAATGG - Intergenic
991946630 5:71904062-71904084 TTGTCTTTCTAGTCCATGGAAGG + Intergenic
996830234 5:127732681-127732703 TTGTCCTTCAGGAACATGGATGG + Intergenic
997298735 5:132786515-132786537 TGCTCCTTCTAGAGGCTGTAGGG - Intronic
997385651 5:133470029-133470051 ATGCCCTTCCAGAGTATGGAAGG - Intronic
998141113 5:139700027-139700049 TAGTCCTTCCAGAGGAGGGTGGG - Intergenic
1000189617 5:158897403-158897425 AGGGCCTTCTAGAGGGTGGAGGG + Intronic
1000445153 5:161310151-161310173 AGGGCCTTCTAGAGGATGGAGGG + Intronic
1001755299 5:174163966-174163988 TGGTCATTGTGGAGGATGGAGGG + Intronic
1002083675 5:176754527-176754549 TAGTCATTCTAGTGGCTGGATGG - Intergenic
1002129273 5:177069961-177069983 TTGTCCCTCAACAGGATGGCTGG - Intronic
1002973648 6:2051204-2051226 GTGTCCTTCTAGAGGCTCCAGGG - Intronic
1003222447 6:4173208-4173230 TTGTCCTGCTTGAGGGTAGAGGG - Intergenic
1003461818 6:6335961-6335983 TTGTCCTTTAAAAAGATGGAAGG + Intergenic
1003491959 6:6630624-6630646 TTGTTGTTCTTGAGGATTGAGGG - Intronic
1006506575 6:34492802-34492824 ATGGACTTCTAGAGGAGGGAAGG + Intronic
1007626955 6:43252063-43252085 TTGTCCTTCTAGAGAAGAAAAGG + Intronic
1009744694 6:67798019-67798041 TTGTACTTTTAGAGGAGGCAGGG - Intergenic
1010659445 6:78552446-78552468 TGGGCCTACTTGAGGATGGAGGG - Intergenic
1013542876 6:111128688-111128710 TGTTCCTTATAGAAGATGGAAGG + Intronic
1017742414 6:157418443-157418465 TTTGCTTTCTAGAGGATGTATGG + Intronic
1018475656 6:164138284-164138306 ATGGCATTCTAGAGGTTGGAAGG + Intergenic
1018668860 6:166163348-166163370 TTGTAGTTTTAGAGGAAGGAAGG - Intronic
1019008691 6:168824870-168824892 TTGTCTTTCTCGGGGTTGGAAGG - Intergenic
1019081299 6:169432179-169432201 TTGTCTTTCTAGTGTAGGGAAGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1021168316 7:17367982-17368004 TTCTCCTTCTAGGAGGTGGAAGG + Intergenic
1021313098 7:19116741-19116763 TTCTCGGTCTGGAGGATGGAGGG - Exonic
1021523177 7:21556677-21556699 GTGGCCTTCTTGAGGGTGGAGGG - Intronic
1024253575 7:47523650-47523672 TTTGCCTTCTGGAGGAAGGAGGG - Intronic
1024494082 7:50023003-50023025 TTGTGCTTCTAGCAAATGGAAGG + Intronic
1024541202 7:50476340-50476362 TTTTCCTTCCAGAGGAATGAGGG + Intronic
1027889983 7:83960796-83960818 TTTTTCTTCTGGATGATGGATGG + Exonic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030330703 7:108267166-108267188 GTTTCCTTCTAGAGCATGGAGGG - Intronic
1032546332 7:132746755-132746777 TTTTCCTCCTGGAGGATGAAAGG + Intergenic
1032696880 7:134344826-134344848 TTGTCCTTCCAAAGCAGGGAGGG - Intergenic
1033205648 7:139419542-139419564 TTATCCTGCTAGGTGATGGAAGG + Intronic
1035732179 8:1860862-1860884 TCTTCATTCCAGAGGATGGAGGG + Intronic
1042071950 8:64945322-64945344 CTATCCTGCTGGAGGATGGAAGG - Intergenic
1043827090 8:84942282-84942304 ATGTCCTTCTAAAGGAGTGAAGG - Intergenic
1043980004 8:86627006-86627028 TTGGCCTACTGGAGGGTGGAGGG - Intronic
1047682655 8:127270258-127270280 TTGTAATTCTAGATGATGGATGG + Intergenic
1048791954 8:138112459-138112481 TTTTCCAGATAGAGGATGGAGGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051056327 9:12991534-12991556 TCTTCCTTTTAAAGGATGGAAGG + Intergenic
1051119509 9:13736716-13736738 GTGTCCTTCTAGAGCACTGAAGG + Intergenic
1051542708 9:18237987-18238009 TTTGCCCTCTAGAGGCTGGAGGG + Intergenic
1051852442 9:21525339-21525361 TGGACCTACTGGAGGATGGAGGG - Intergenic
1052567962 9:30182775-30182797 GGGACCTACTAGAGGATGGAGGG - Intergenic
1052676967 9:31639003-31639025 ATGTTCATCTATAGGATGGATGG + Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057781151 9:98051602-98051624 ATGCCCTTCTAGAGGAGTGAAGG + Intergenic
1058942368 9:109824953-109824975 TTGTGCTCCAAGAGGATCGAAGG + Intronic
1059284922 9:113164262-113164284 TTGTCTTTGTAGCAGATGGATGG - Intronic
1059358540 9:113720184-113720206 TTGTCCTTCCAAAGGAAGGAAGG - Intergenic
1059373321 9:113861510-113861532 TTGTCCTGCTATGGGAGGGAAGG + Intergenic
1059860463 9:118454933-118454955 TAATCCTTCCAGATGATGGAAGG - Intergenic
1061825758 9:133257281-133257303 TTGTCCTCCCAGAGGGTAGATGG - Intronic
1186282355 X:8006883-8006905 TTGTTCTTTCAAAGGATGGAGGG - Intergenic
1188804689 X:34572282-34572304 GTGGACTACTAGAGGATGGAAGG + Intergenic
1188850790 X:35129287-35129309 AAGGCCTACTAGAGGATGGAGGG - Intergenic
1189630689 X:42949477-42949499 TAGTCCTTCTAAAGTTTGGAGGG + Intergenic
1189809518 X:44768337-44768359 ATGGACTCCTAGAGGATGGAGGG + Intergenic
1190737884 X:53267600-53267622 TTGTCCTTCAAGAGCAGGGTGGG - Intronic
1192616194 X:72625256-72625278 AGGACCTTCTTGAGGATGGAGGG - Intronic
1193746925 X:85293506-85293528 TTGGCCTTTTAGAAGGTGGAAGG + Intronic
1194435646 X:93865931-93865953 TTGTCCTTTGACAGCATGGATGG + Intergenic
1195499003 X:105572187-105572209 TTGTGGTTCCAGAGCATGGAGGG - Intronic
1196761367 X:119203444-119203466 TGGTCATTCAAGAGGATAGAGGG - Intergenic
1198068436 X:133123368-133123390 TGGGCCTTCTTGAGGGTGGAGGG - Intergenic
1198232711 X:134707456-134707478 TTGGCCTGTCAGAGGATGGAGGG - Intronic
1201440637 Y:14004761-14004783 TTGTTCTTTCAGTGGATGGAGGG - Intergenic
1201443934 Y:14037947-14037969 TTGTTCTTTCAGTGGATGGAGGG + Intergenic
1202270066 Y:23062880-23062902 TGGTTCCTCTAGAGGTTGGATGG - Intergenic
1202295961 Y:23357802-23357824 TGGTTCCTCTAGAGGTTGGATGG + Intergenic
1202423060 Y:24696625-24696647 TGGTTCCTCTAGAGGTTGGATGG - Intergenic
1202447729 Y:24973461-24973483 TGGTTCCTCTAGAGGTTGGATGG + Intergenic