ID: 1153232326

View in Genome Browser
Species Human (GRCh38)
Location 18:2950724-2950746
Sequence TTGGACACCATGTCATCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153232326_1153232331 -3 Left 1153232326 18:2950724-2950746 CCCAGAGATGACATGGTGTCCAA 0: 1
1: 0
2: 1
3: 8
4: 131
Right 1153232331 18:2950744-2950766 CAACTGGATCTGCTCACCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 51
1153232326_1153232332 -2 Left 1153232326 18:2950724-2950746 CCCAGAGATGACATGGTGTCCAA 0: 1
1: 0
2: 1
3: 8
4: 131
Right 1153232332 18:2950745-2950767 AACTGGATCTGCTCACCGAGGGG 0: 1
1: 0
2: 0
3: 4
4: 63
1153232326_1153232330 -4 Left 1153232326 18:2950724-2950746 CCCAGAGATGACATGGTGTCCAA 0: 1
1: 0
2: 1
3: 8
4: 131
Right 1153232330 18:2950743-2950765 CCAACTGGATCTGCTCACCGAGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153232326 Original CRISPR TTGGACACCATGTCATCTCT GGG (reversed) Intronic
900853968 1:5165629-5165651 TTGGACTCTGTGTCATCACTCGG + Intergenic
902705934 1:18204500-18204522 TTGGCCACCAGTTCACCTCTTGG + Intronic
903890529 1:26567343-26567365 TTGGACAGCATCTGGTCTCTAGG + Intronic
906221749 1:44085967-44085989 TTGGACACCTTTTCTTCACTTGG - Intergenic
907694253 1:56705807-56705829 CTGGACCCTATGTAATCTCTGGG + Intronic
907759923 1:57347647-57347669 TTGGACAACAAAACATCTCTAGG - Intronic
911461329 1:98194783-98194805 TTAGAAAATATGTCATCTCTAGG + Intergenic
913120357 1:115734569-115734591 TTGGAGCTCAGGTCATCTCTAGG + Intronic
913193889 1:116437450-116437472 GTGGATGCCATGTCATTTCTAGG + Intergenic
917695642 1:177520461-177520483 CTGGGCACCATGTTCTCTCTTGG - Intergenic
919076626 1:192821494-192821516 ATGTTCACCATGTCATCTCTGGG + Intergenic
921352155 1:214246924-214246946 TTGGACAGCAGGACAACTCTGGG - Intergenic
923556815 1:235007562-235007584 AAAGACACCATGTCCTCTCTTGG - Intergenic
923633368 1:235670606-235670628 TTGGTCACCATGGCATCTGTAGG - Intronic
1063542213 10:6945246-6945268 TCAGACCCCATGTCCTCTCTCGG + Intergenic
1064804141 10:19111678-19111700 TTGCAAACAATGTCATCTCCTGG + Intronic
1068097961 10:52515700-52515722 TTGAGCACCCTGACATCTCTAGG + Intergenic
1069762401 10:70820985-70821007 GTGGACTCCAGGTCATCTCCAGG - Intronic
1070017144 10:72544377-72544399 CTGGACTCCATATTATCTCTAGG - Intronic
1070423602 10:76263160-76263182 TGGGTCACCTTTTCATCTCTAGG + Intronic
1072741940 10:97914905-97914927 GTGGCCACCATGCCAGCTCTCGG - Intronic
1075198736 10:120383477-120383499 TTGGTTCCCATGTCATCTTTTGG + Intergenic
1075958471 10:126545996-126546018 TTCGTCACCATGTCATTTTTGGG - Intronic
1079043582 11:17080319-17080341 CTGGCCTCCATGTCATCTCAGGG + Intronic
1079927792 11:26517116-26517138 CTGGACACTATGTCATTTCAAGG + Intronic
1080155749 11:29108651-29108673 TTGCACAGCATCTCATCTCCAGG - Intergenic
1084561709 11:69909302-69909324 TTGGACGCCAGCTCCTCTCTGGG + Intergenic
1089449177 11:118579843-118579865 ATGAACATCATGTCATCACTGGG + Intronic
1091661474 12:2387108-2387130 TTGCACACCACTGCATCTCTAGG - Intronic
1092525479 12:9307057-9307079 TTAAACACCATTTAATCTCTAGG - Intergenic
1092541793 12:9424763-9424785 TTAAACACCATTTAATCTCTAGG + Intergenic
1094302600 12:28982376-28982398 TTGGACTCCATTTCTTCACTTGG + Intergenic
1094511237 12:31097740-31097762 TTAAACACCATTTAATCTCTAGG - Intronic
1096210369 12:49760742-49760764 TTCGACACCATGTCCTCACGGGG - Intronic
1096551254 12:52373405-52373427 TTGACCCCTATGTCATCTCTGGG + Intergenic
1104625237 12:130347749-130347771 TTGAAAGCCATGTCATCTCTTGG + Intronic
1112163968 13:96897906-96897928 TTGGACCCAGTGTTATCTCTGGG + Intergenic
1113065228 13:106367049-106367071 TTGGAGACCATTTCATCTCTTGG + Intergenic
1113871582 13:113563110-113563132 TTGGCCCCTATGTCATCTCAGGG - Intergenic
1115983025 14:39074425-39074447 TGGGACAGCATTTCATCTCCAGG + Exonic
1119639999 14:76307823-76307845 CGGGACACCAGGGCATCTCTGGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1127168651 15:56275232-56275254 TAGCAAACCATGTCATCCCTAGG - Intronic
1135784804 16:25339261-25339283 TTGGACGTCTTATCATCTCTTGG + Intergenic
1136991032 16:35151509-35151531 CTGGAAACCATGCCATGTCTTGG + Intergenic
1137424035 16:48362209-48362231 TTGGACAACATGTGAGCTTTGGG + Exonic
1137915121 16:52421597-52421619 TTGGACACCATTTCCACTCATGG + Intergenic
1139324338 16:66140368-66140390 TTTGACACCATGGGATCTCAAGG - Intergenic
1139392431 16:66613250-66613272 TTGGAAACCATGTCTTCTGGGGG + Exonic
1139565727 16:67774627-67774649 TTGGGCACCATTCCACCTCTAGG + Intronic
1151172054 17:72255086-72255108 TTGAGCATCATTTCATCTCTTGG - Intergenic
1151274456 17:73023437-73023459 TTGGACACCTTTTCAACTCTTGG - Intronic
1152976809 18:229019-229041 TTGGAAAGCATTTCATTTCTTGG + Intronic
1153232326 18:2950724-2950746 TTGGACACCATGTCATCTCTGGG - Intronic
1153437214 18:5080232-5080254 TAGGACCCTATGTCATTTCTTGG + Intergenic
1154250945 18:12744539-12744561 TTAAAAACCATGTCATCTCAAGG - Intergenic
1154958635 18:21285483-21285505 TTGGAGGCCAGGTCATATCTGGG + Intronic
1155160550 18:23192171-23192193 TTGGACACCAGGTAACCACTAGG - Intronic
1155561262 18:27079900-27079922 GTGGACTCCATGTCATCACAAGG - Intronic
1158549900 18:58426866-58426888 TGGGACACCATGTCATGTCATGG - Intergenic
1159183677 18:64943556-64943578 TTGGCCACCATTGCCTCTCTGGG - Intergenic
1159842904 18:73420492-73420514 TTGCACAGCATGTAATCTTTTGG - Intergenic
1160956370 19:1693974-1693996 TTGGAGATCATCTAATCTCTGGG - Intergenic
1161651333 19:5487305-5487327 ATGGAGACCATATCAGCTCTTGG - Intergenic
1162178407 19:8848709-8848731 TTTCGCACCATGTCATCCCTTGG - Intergenic
1162529123 19:11225470-11225492 TTAGACACCAGGCCATCTCCTGG + Intronic
1163312327 19:16521902-16521924 TTGGAGACCATGTCCCCTGTGGG - Intronic
926073798 2:9923874-9923896 TGGCACACCATGTCTTCACTTGG - Intronic
927424382 2:22964908-22964930 TTGGGAATCATGTCAACTCTAGG - Intergenic
928368906 2:30724627-30724649 CTGGACACCCTGGCATCTCAAGG + Intronic
928442654 2:31304984-31305006 TGGGACTCCCTGTGATCTCTGGG - Intergenic
930367265 2:50455841-50455863 TTAGACATTATGTCATCACTTGG + Intronic
931325701 2:61220125-61220147 TAGGAAACCATGTTATTTCTTGG - Intronic
934588684 2:95527275-95527297 CTGGGCACCATGGCAGCTCTCGG + Intergenic
935666187 2:105515159-105515181 TTCATCACCATATCATCTCTTGG + Intergenic
940342686 2:152598200-152598222 AGGGACACAATGACATCTCTAGG - Intronic
941656586 2:168151038-168151060 TTGGACACCATGCCATGGTTGGG - Intronic
943713637 2:191125842-191125864 TTTGTCCCCAGGTCATCTCTAGG + Intronic
945951396 2:216042095-216042117 TTGGACACCATCACAAGTCTGGG - Intronic
948979007 2:241483269-241483291 TTGGTCACCAGGTCCTGTCTTGG - Intronic
1170306497 20:14944519-14944541 TTTGACATCATCCCATCTCTGGG + Intronic
1173147583 20:40537979-40538001 TGGGGCACCCTGGCATCTCTGGG - Intergenic
1173592929 20:44239548-44239570 TTGGAAATAATGTCACCTCTCGG + Intergenic
1175214543 20:57384778-57384800 TGGGGCTTCATGTCATCTCTTGG + Intergenic
1177731373 21:25031032-25031054 ACGGACACCCTGGCATCTCTAGG + Intergenic
1179482373 21:41686311-41686333 TTGCACATCATGTCATCTCAAGG + Intergenic
1181665919 22:24396942-24396964 TTGAACACCAGCTCTTCTCTGGG + Intronic
1182281802 22:29221672-29221694 TTGGACAAAATGTCATATCCTGG - Intronic
1182880843 22:33732127-33732149 GTAGGCACCATGTCACCTCTAGG + Intronic
1184908651 22:47510313-47510335 CAAAACACCATGTCATCTCTTGG - Intergenic
950499939 3:13357415-13357437 CTGGTCTCCCTGTCATCTCTGGG + Intronic
953449698 3:42995939-42995961 TTGGAGACCCTGTCATTTGTTGG - Intronic
954590145 3:51776101-51776123 GGGGACACCATGTCATCTGAGGG + Intergenic
969240836 4:5896255-5896277 TTCCACACCATCTCATCTCAAGG + Intergenic
970708125 4:18829970-18829992 TTGGACACTATGTCAATTCATGG + Intergenic
976018389 4:80588584-80588606 TTGGACACCAAATCATATTTGGG - Intronic
977343180 4:95786393-95786415 TAGGACACCATTCCATCTCAGGG + Intergenic
981559329 4:146029900-146029922 TTGGAAACAATTTCCTCTCTTGG - Intergenic
989749110 5:44869553-44869575 TTGGACATCATGTTTTCTTTTGG - Intergenic
989974166 5:50562601-50562623 TTGGACAGCCTTTCATCTGTGGG + Intergenic
990555463 5:56930391-56930413 TTGGACATATTGTCATGTCTGGG + Intronic
992895981 5:81245591-81245613 TAGGGCACAATGTCATCACTGGG + Intronic
993798870 5:92303824-92303846 TTGGCCACTGTGTCCTCTCTCGG + Intergenic
994635855 5:102343722-102343744 TTGGACAACTAGTCATATCTCGG - Intergenic
1000244422 5:159437465-159437487 TTGTACAGCAGGTCATCTGTGGG + Intergenic
1003780077 6:9415121-9415143 TAGGACACAATGTCATATCGTGG - Intergenic
1005352501 6:24950012-24950034 TTTGACACTAGGTCATCTCTAGG - Intronic
1005811727 6:29521013-29521035 TCAGACACCATGTCATGTTTTGG + Intergenic
1005960390 6:30689336-30689358 TTGTGCTCCATGTCATCTCCTGG - Exonic
1009985949 6:70781407-70781429 TTGCACTCCATGGCATATCTTGG - Intronic
1010686749 6:78861852-78861874 TTGGACACCATCTTTTTTCTTGG + Intergenic
1011546258 6:88484590-88484612 TTTGACACGATCTCAGCTCTCGG - Intergenic
1019930736 7:4221253-4221275 TTGGTGACCAGGACATCTCTAGG - Exonic
1024157307 7:46638609-46638631 TCGGTCACCATGTCATTTTTAGG + Intergenic
1025974161 7:66356476-66356498 TTGGAGCCCACGTCAACTCTGGG - Intronic
1029146312 7:98448613-98448635 GTGGACAGCAGCTCATCTCTTGG + Intergenic
1033629858 7:143147050-143147072 TAAGACACCATGTCATCTAGAGG + Intergenic
1034274110 7:149816610-149816632 TTGCAGACCCTGTCATCCCTGGG + Intergenic
1034503072 7:151463980-151464002 TTGGAAACCTGGTCCTCTCTTGG - Intergenic
1035181383 7:157091905-157091927 ATGGACCCCATGTCATCCCAGGG + Intergenic
1035186506 7:157130206-157130228 GTGGACCCCATGTCATCCCAGGG + Intergenic
1035470054 7:159104028-159104050 CTGGACAGCAGGTCACCTCTCGG + Intronic
1039205302 8:35146462-35146484 TTGGGCACCAAGTTATCTTTAGG + Intergenic
1042274087 8:66985302-66985324 TTGGACTCCATGTCTTCTGATGG + Intronic
1042879986 8:73476798-73476820 TTGGCCAGCAAGTCATCTGTGGG - Intronic
1043950156 8:86299733-86299755 TTTAACTTCATGTCATCTCTTGG + Intronic
1046706736 8:117461893-117461915 TTGTTCACCATTTTATCTCTAGG + Intergenic
1050620533 9:7447596-7447618 ATGTTCACCATCTCATCTCTGGG - Intergenic
1051060006 9:13034753-13034775 TAGGACACCATTTGCTCTCTTGG - Intergenic
1056933037 9:90894276-90894298 TTGGCCACCATATCCCCTCTCGG + Intronic
1057280349 9:93706599-93706621 TTGGTCACCATGGGAACTCTAGG + Intergenic
1058548040 9:106081923-106081945 TTGGAAGCCTTGTCATCTCTAGG - Intergenic
1186590217 X:10922478-10922500 TTGGAGAAGATGTTATCTCTAGG + Intergenic
1187283929 X:17884702-17884724 ATCCACCCCATGTCATCTCTAGG - Intergenic
1188759462 X:34008656-34008678 TTGCACACAATTTCAGCTCTGGG + Intergenic
1189058738 X:37728870-37728892 TTGGTCACCAGGACAGCTCTTGG - Exonic
1189249402 X:39588273-39588295 TTAGTCACCATGTCATGGCTAGG - Intergenic
1194057370 X:89151951-89151973 TTGCACCCCATGGCATCTCAGGG + Intergenic
1200291176 X:154875862-154875884 TTTGACACCTTGACATGTCTGGG + Intronic
1201516475 Y:14823808-14823830 TATGATACCATGTCATCTTTGGG - Intronic
1201516486 Y:14823966-14823988 TATGATACCATGTCATCTTTAGG - Intronic