ID: 1153234102

View in Genome Browser
Species Human (GRCh38)
Location 18:2969353-2969375
Sequence GAATCGTTCTGAGCTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153234096_1153234102 21 Left 1153234096 18:2969309-2969331 CCTGTCCTTTGTCTTTTACAGAG 0: 1
1: 0
2: 0
3: 24
4: 294
Right 1153234102 18:2969353-2969375 GAATCGTTCTGAGCTGGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 73
1153234097_1153234102 16 Left 1153234097 18:2969314-2969336 CCTTTGTCTTTTACAGAGAAAAA 0: 1
1: 1
2: 4
3: 79
4: 704
Right 1153234102 18:2969353-2969375 GAATCGTTCTGAGCTGGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153234102 Original CRISPR GAATCGTTCTGAGCTGGTGT TGG Intronic
904487741 1:30838724-30838746 GCATTGTTCAGAGCTGGGGTGGG - Intergenic
905626798 1:39494816-39494838 GAAGTGCTCAGAGCTGGTGTGGG - Intronic
911207023 1:95102063-95102085 GAATTCTTCTGACCTGCTGTTGG - Intergenic
911886678 1:103309982-103310004 TAATCTTTCTGAGCAGGTCTGGG - Intergenic
915741513 1:158122091-158122113 GAACTGCTCTGAGCTGATGTTGG + Intergenic
920381303 1:205536099-205536121 GAATCAATCTGAGCTGGGGCCGG - Intergenic
923048892 1:230376404-230376426 GGATCATTCTGAGGTGGTGTTGG - Intronic
1066043321 10:31574994-31575016 AAACCCTTCTCAGCTGGTGTGGG + Intergenic
1066285709 10:33964151-33964173 GAAATGTTCTGAGTTGGTTTTGG - Intergenic
1067003453 10:42638739-42638761 GATGCGGTCTGAGTTGGTGTGGG + Intergenic
1072234441 10:93440962-93440984 GAAATGATCTGAGCTGGTTTGGG - Intronic
1074129573 10:110561889-110561911 AAATCGTTGTGACCTTGTGTTGG - Intergenic
1074129839 10:110564271-110564293 GAATCAATCTGAGGTGGGGTTGG + Intergenic
1074546200 10:114404051-114404073 GAACCGTGCTGAGCTGCTGGGGG - Intronic
1075603904 10:123790646-123790668 GAATCCTTCTCAGCTGAGGTGGG - Intronic
1076562377 10:131375556-131375578 GCATCGTCCTGACCTGGGGTGGG + Intergenic
1077358174 11:2128139-2128161 GAGTGGTTCTCAGATGGTGTGGG + Intergenic
1080728205 11:34917893-34917915 GATTCGGTCTGGTCTGGTGTGGG + Intronic
1084401129 11:68943731-68943753 TAAGCGTTCTGAGCATGTGTAGG + Intergenic
1089217118 11:116841140-116841162 GAAACGTTCTGAGCAGGGGCTGG - Intergenic
1102985876 12:117277981-117278003 GATTCCTCCAGAGCTGGTGTTGG - Exonic
1103434629 12:120915243-120915265 GACTTGTTCTGGGATGGTGTGGG + Intergenic
1109742697 13:66575452-66575474 GAATGGTTCTTAACTGGTTTTGG + Intronic
1113014840 13:105817359-105817381 GTATCGTTCTGAACTGCTGCAGG - Intergenic
1121388407 14:93551966-93551988 GAATCCTTCTGGGATGGTATGGG + Intronic
1121792531 14:96709911-96709933 GGAGGGTTCTGAGCAGGTGTTGG - Intergenic
1124131013 15:26985655-26985677 GCATTTTTCTGAGCTGGTCTTGG + Intronic
1135907358 16:26525183-26525205 CATTCCTTCTGAGCTGGTGCTGG + Intergenic
1136170879 16:28488615-28488637 AAATCGTGATGAGCTGTTGTGGG + Exonic
1137229158 16:46546280-46546302 GAATGGCCCTGGGCTGGTGTTGG + Intergenic
1137395516 16:48114115-48114137 GCATCATGCTGGGCTGGTGTGGG - Intronic
1141574302 16:84954268-84954290 GAACCTTTCTGAGCTGCGGTCGG + Intergenic
1143618425 17:8067360-8067382 GCATTGTTCTGAGATGGTGAGGG + Intergenic
1147678777 17:42225760-42225782 GAATATTTCTGAGCTGCGGTTGG + Intronic
1152025610 17:77807162-77807184 GAACCGTTTTGAGATGCTGTGGG + Intergenic
1153234102 18:2969353-2969375 GAATCGTTCTGAGCTGGTGTTGG + Intronic
1158043923 18:53132351-53132373 GAGTCGACCTGAGCTGCTGTAGG + Intronic
1163131900 19:15279359-15279381 CAAACTTTCTGAGCTGGTTTTGG - Intronic
1163356431 19:16814823-16814845 AAATCGCCCTGAGCAGGTGTAGG + Intronic
1168629114 19:57943443-57943465 GAGTCATTCTGGGCTGGTCTTGG - Intronic
935345593 2:102104754-102104776 GAAGCCTGCTGAGCTGATGTTGG - Intronic
1169636299 20:7695789-7695811 GAATCTTTCTGAGGTGGTTTGGG - Intergenic
1170485424 20:16810866-16810888 GCATCCTTCACAGCTGGTGTAGG + Intergenic
1171449306 20:25224841-25224863 GGATTGTTCTGAGCTGGCTTTGG + Intronic
1173085684 20:39914261-39914283 GAAAAGTTCCGAGCTGGGGTAGG - Intergenic
1173298688 20:41781654-41781676 GAATCAAACTGAGCTGGAGTGGG + Intergenic
1173654398 20:44689868-44689890 GATTCGTTGTGGGCTGGGGTGGG + Intergenic
1178621560 21:34181550-34181572 GAATCGTTCTGAGATGAAGCAGG - Intergenic
1180939020 22:19644774-19644796 GAACCTTTCTGAGATGGTGATGG - Intergenic
1182819370 22:33201845-33201867 GAATCATTCTGGGCTGGGCTTGG + Intronic
955706882 3:61737022-61737044 AAATCTTGATGAGCTGGTGTTGG - Intronic
960765640 3:121127078-121127100 TAATTGTTCTGAGATGATGTAGG - Intronic
962254992 3:133864506-133864528 GAAACTTGCTGAGCTGGGGTGGG - Intronic
962853759 3:139326788-139326810 CAAGGGTTCTGAGCTGGTGTAGG + Intronic
963035191 3:141019601-141019623 GGATGGTTCTGACTTGGTGTAGG + Intergenic
968440598 4:622045-622067 GGCTCCTCCTGAGCTGGTGTGGG - Intergenic
971367226 4:25986943-25986965 AAATCCTCCTGAGCGGGTGTGGG + Intergenic
973151779 4:46897362-46897384 GAATCCAGCTGAGCTGGTGTTGG - Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
979068814 4:116174182-116174204 GAATCTTTGTGTGCTAGTGTTGG + Intergenic
983742733 4:171155368-171155390 GCAGAGTTCTGAGCTGGTGCAGG - Intergenic
985910143 5:2872931-2872953 GACTGGGGCTGAGCTGGTGTGGG - Intergenic
997822527 5:137078858-137078880 GAATGGTTGTAAGCTGGGGTAGG - Intronic
997996444 5:138590556-138590578 TAATTGCTCTGAGCAGGTGTCGG - Intergenic
997996945 5:138594498-138594520 GATTTGTTCAGAGCTTGTGTGGG - Intergenic
998886114 5:146695923-146695945 GAATCATTTTGAGATGCTGTTGG + Intronic
1001717355 5:173827237-173827259 GAAGCATTCAGAGCTGGTATGGG + Intergenic
1004006903 6:11645359-11645381 GAACTGTTCTGAGCTTGTTTTGG + Intergenic
1006253587 6:32811548-32811570 AAACCATTCTGAGATGGTGTGGG - Intergenic
1006556483 6:34871532-34871554 AAATTGCTCTGAGCTGGTGGGGG + Intronic
1012069694 6:94597834-94597856 CAATGGTTCTCAGCTGGTTTAGG - Intergenic
1012838352 6:104297753-104297775 GAATAGTACTGAGGTGGTTTAGG + Intergenic
1046867501 8:119167160-119167182 GAAGCCTTCTGAGCTGGAGTAGG + Intronic
1047197928 8:122738297-122738319 GACTCTTTCTGAGGGGGTGTGGG - Intergenic
1058485885 9:105443133-105443155 GAATGGTTCTGCCCTGATGTGGG - Intergenic
1061494428 9:130963604-130963626 GAATCCTGCTGGGCTGGTTTAGG - Intergenic
1188023402 X:25183615-25183637 GAATCTTTCTTAGTTGGTGCGGG + Intergenic
1190679538 X:52812987-52813009 GAATCGTTTTGGGATAGTGTAGG + Intronic
1194401313 X:93440400-93440422 CAAGCGGTCTGTGCTGGTGTTGG - Intergenic