ID: 1153234102

View in Genome Browser
Species Human (GRCh38)
Location 18:2969353-2969375
Sequence GAATCGTTCTGAGCTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153234097_1153234102 16 Left 1153234097 18:2969314-2969336 CCTTTGTCTTTTACAGAGAAAAA No data
Right 1153234102 18:2969353-2969375 GAATCGTTCTGAGCTGGTGTTGG No data
1153234096_1153234102 21 Left 1153234096 18:2969309-2969331 CCTGTCCTTTGTCTTTTACAGAG No data
Right 1153234102 18:2969353-2969375 GAATCGTTCTGAGCTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153234102 Original CRISPR GAATCGTTCTGAGCTGGTGT TGG Intronic