ID: 1153235793

View in Genome Browser
Species Human (GRCh38)
Location 18:2985977-2985999
Sequence GAAAATGCAGAAATGCACTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 385}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153235793_1153235798 17 Left 1153235793 18:2985977-2985999 CCTAAGTGCATTTCTGCATTTTC 0: 1
1: 0
2: 0
3: 48
4: 385
Right 1153235798 18:2986017-2986039 AGGGAACATGTAAAGGACCATGG 0: 1
1: 0
2: 0
3: 13
4: 183
1153235793_1153235794 -3 Left 1153235793 18:2985977-2985999 CCTAAGTGCATTTCTGCATTTTC 0: 1
1: 0
2: 0
3: 48
4: 385
Right 1153235794 18:2985997-2986019 TTCAAGACTCCTCATGACAAAGG 0: 1
1: 0
2: 0
3: 5
4: 141
1153235793_1153235797 10 Left 1153235793 18:2985977-2985999 CCTAAGTGCATTTCTGCATTTTC 0: 1
1: 0
2: 0
3: 48
4: 385
Right 1153235797 18:2986010-2986032 ATGACAAAGGGAACATGTAAAGG 0: 1
1: 0
2: 0
3: 40
4: 277
1153235793_1153235795 -2 Left 1153235793 18:2985977-2985999 CCTAAGTGCATTTCTGCATTTTC 0: 1
1: 0
2: 0
3: 48
4: 385
Right 1153235795 18:2985998-2986020 TCAAGACTCCTCATGACAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153235793 Original CRISPR GAAAATGCAGAAATGCACTT AGG (reversed) Intronic
902435777 1:16397456-16397478 GAAAAGGAAAAAAAGCACTTAGG - Exonic
903586181 1:24416919-24416941 GCAAAACCAGAAAAGCACTTGGG + Intronic
908579446 1:65499281-65499303 GAAAATGCAGGAATTCTCTTTGG - Intronic
909003959 1:70253848-70253870 AAAAATGCAAATAGGCACTTGGG + Intergenic
909090916 1:71224461-71224483 AAAAATGCAGAAGGCCACTTGGG + Intergenic
910246905 1:85148757-85148779 GGAAATGCTGAACTGCACATAGG - Intergenic
910475987 1:87608029-87608051 AAACAAGCAGAAATTCACTTAGG + Intergenic
911257994 1:95654235-95654257 CAAAATGCAGGAAAGCAATTAGG - Intergenic
911418963 1:97615239-97615261 GAAAATGAAGAATCGCATTTTGG - Intronic
911643469 1:100313841-100313863 GTAAATGGAGAAATAAACTTTGG - Intergenic
911785210 1:101937743-101937765 GAAAATGTAAAAGTGAACTTTGG - Intronic
912754162 1:112310433-112310455 GAAAATGGAGAAATGAAGTCTGG - Intergenic
912985194 1:114420922-114420944 GATAATGCTGAAATGAACATGGG - Intronic
914783069 1:150803336-150803358 GAAAAAGAAAAAATGCACTAAGG + Intronic
915377828 1:155413130-155413152 GAGAAAGTAGAAATACACTTTGG - Intronic
918477835 1:184944535-184944557 GGTAATGCAGGAATGGACTTTGG + Intronic
919176385 1:194024207-194024229 AAAAATACAGAAAAGCTCTTTGG + Intergenic
919265752 1:195262736-195262758 GAAAATGAAGGAATGCTATTAGG - Intergenic
920411068 1:205761419-205761441 GAAAAAACAGAAATGAATTTTGG - Intergenic
920412085 1:205770164-205770186 GGAGATGCAGAAATGCACATGGG + Exonic
921647020 1:217631046-217631068 CAAAATGCTGAACTGCTCTTTGG - Exonic
921818585 1:219591515-219591537 GAAAATGTAGAAAAGCACAAAGG - Intergenic
921945436 1:220882977-220882999 GAACCTGCTGAAATGCTCTTGGG - Intronic
922940419 1:229459803-229459825 GAAAATGCTGCAATGAACATGGG + Intronic
923862256 1:237903504-237903526 GAAACTGTATAAATTCACTTTGG + Intergenic
924240118 1:242032274-242032296 GAAAATGAAGAGATGCGCTAGGG + Intergenic
924362263 1:243254704-243254726 GAAAATGATTCAATGCACTTAGG + Intronic
924769256 1:247064566-247064588 GAAAAGGCAGAAAGGCCCTGTGG - Intronic
1062883689 10:999571-999593 GAAAATGCAGAAATCCACACTGG - Intronic
1063476076 10:6330250-6330272 AATGATGCAGAAATGCACTTGGG + Intergenic
1063853894 10:10224767-10224789 GAAGATGCAGAACTGCAATGGGG - Intergenic
1064009578 10:11724980-11725002 GAAAATGCTGAAATGTATGTTGG - Intergenic
1065073192 10:22049008-22049030 GAAAATGCAGTAATGCTCGCTGG - Intergenic
1065764643 10:29016536-29016558 TAAAATGCAGAACTGCACATGGG - Intergenic
1066603970 10:37140931-37140953 AAAAATGCAGAAATTCAATAAGG - Intronic
1067260214 10:44683002-44683024 CAAAATGCAAAACTGGACTTAGG - Intergenic
1067302907 10:45030822-45030844 GGAAATGCAGAAATGCAGGAGGG - Intergenic
1067317778 10:45184868-45184890 AAAAATGCAGAAATTCAATAGGG + Intergenic
1068380063 10:56241210-56241232 GATAATGCAGAAAGGCTTTTTGG - Intergenic
1069077984 10:64058401-64058423 GTAAAGGCAGAAATGAAATTAGG + Intergenic
1070042455 10:72794923-72794945 TCAAATGAAGAAATGCACTCTGG - Intronic
1073690602 10:105804655-105804677 AAATTTGCAGTAATGCACTTTGG + Intergenic
1073726742 10:106240773-106240795 GAAAATTAACAAATGCACATAGG - Intergenic
1079780859 11:24602437-24602459 GAAAATAAATAAATGCACTATGG + Intronic
1079927759 11:26516593-26516615 GAAAATGCACTAATGCACATAGG + Intronic
1080136108 11:28857059-28857081 GTTAATGCTGAAATGAACTTTGG - Intergenic
1080713697 11:34775858-34775880 TAAAATGGATAAATGCATTTTGG - Intergenic
1080779369 11:35417217-35417239 TAAAATGCCGAAAATCACTTTGG + Intronic
1080911748 11:36607564-36607586 GATAATGCCCAAATGCATTTGGG - Intronic
1081501849 11:43674796-43674818 GAAAATGCAGAAATTGAGTGAGG - Intronic
1081551997 11:44121979-44122001 GACCATGCAGAAATGCCCTCTGG + Intronic
1081577307 11:44327161-44327183 GAAAATACAGCAATGCACATGGG + Intergenic
1086372849 11:86172181-86172203 GAAAAAGAAGAAATGGCCTTTGG + Intergenic
1087020667 11:93599667-93599689 GCAAATGCTGAGATGAACTTAGG + Intergenic
1088068929 11:105757180-105757202 GAAAGTGGAGAAATGAACTGAGG + Intronic
1088387020 11:109270068-109270090 AAAAATGATGAAATGTACTTTGG - Intergenic
1089934019 11:122344843-122344865 GATAATGCAGAATTTCATTTTGG - Intergenic
1090291242 11:125547004-125547026 CAAAATGGAGAAATACAATTCGG - Intergenic
1090355505 11:126137872-126137894 GAAAATGCTCAAATGCTCTGGGG - Intergenic
1092086391 12:5766316-5766338 TAAAATGGATAAATGCATTTTGG + Intronic
1093423254 12:18999005-18999027 GAAAAAGCAGGAATCTACTTGGG + Intergenic
1094136576 12:27133379-27133401 GAAAATACAAGAATGCAATTTGG - Intergenic
1094236889 12:28178159-28178181 GAAAATGGACTAATACACTTGGG + Intronic
1094267727 12:28577586-28577608 GAAAAAGAACAAATGCACTGTGG + Intronic
1094367959 12:29704083-29704105 GAAAATGTACAAATACACTTAGG + Intronic
1094660365 12:32464517-32464539 GAAAAAGGACAAATGCACATAGG + Intronic
1094715307 12:33008036-33008058 GAAAATGCAGAAATACCTTAAGG - Intergenic
1095302321 12:40598970-40598992 GAAATTCCAGAAATGGAATTTGG - Intergenic
1097496370 12:60342296-60342318 GAAAATGAAAAAAAGTACTTTGG - Intergenic
1097827314 12:64187373-64187395 GAAAATGGAGAGATGCAAATGGG - Intronic
1098443307 12:70540497-70540519 GATATTTCAGAAAAGCACTTGGG + Intronic
1099455005 12:82852543-82852565 GAAAATTCAGAAAGGCACTAAGG - Intronic
1100686207 12:96988743-96988765 CAGAATGGAGAAAAGCACTTTGG - Intergenic
1100840415 12:98607238-98607260 GAAAATACAAAAATTCACTTAGG + Intergenic
1101002099 12:100366876-100366898 GAAAATTCAGAACTACAGTTAGG - Intronic
1101137893 12:101764305-101764327 GAAAATGCTGAAAATCACATAGG - Exonic
1103031543 12:117618444-117618466 GGAAATGCAGTATTGAACTTTGG + Intronic
1103103458 12:118201493-118201515 GATAATGAAGAAATGTCCTTAGG + Intronic
1103198196 12:119064698-119064720 GAAAATATATAAATGTACTTTGG + Intronic
1103381042 12:120494796-120494818 GAAAATGTAGAAATGTAAATAGG + Intronic
1104301367 12:127568073-127568095 GAACATGCAGAAAATCAATTGGG + Intergenic
1104376774 12:128269970-128269992 GAAAAGGCAGAATTGTTCTTGGG + Intronic
1104626215 12:130357838-130357860 GAAAATACAGAAAAGCACAGAGG + Intronic
1105642122 13:22276517-22276539 GAAAAATCAGAAATTCTCTTTGG - Intergenic
1106264464 13:28097933-28097955 GATAATGCAGAAAAGCCCATTGG + Intronic
1106547889 13:30746129-30746151 CAAATTGCAGAAGTGCCCTTTGG + Intronic
1106987186 13:35369004-35369026 GAAAATGCAGGCAAACACTTCGG - Intronic
1108009509 13:45990412-45990434 GAATATGCAGAAAAGAATTTAGG + Intronic
1108295446 13:49012371-49012393 AAAAATCCATAAATACACTTTGG - Intronic
1108365747 13:49710384-49710406 GAGAAAGAAGAAATGCAATTAGG + Intronic
1108390380 13:49941611-49941633 GAAAATGCAAAAAACTACTTTGG - Intergenic
1108844667 13:54662977-54662999 GAAAATTCAGGAATAAACTTTGG + Intergenic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1109211184 13:59537830-59537852 GAAGGTCCAGAAATGCAGTTTGG + Intergenic
1110802481 13:79715400-79715422 GAAAATGGACTAATACACTTTGG - Intergenic
1111103753 13:83619789-83619811 GGAAATGCAAAATTACACTTTGG + Intergenic
1111286989 13:86107056-86107078 GATAATGCTGAAATAAACTTTGG + Intergenic
1112066799 13:95801409-95801431 AAAATTACAGAAATGCATTTAGG - Intergenic
1112520213 13:100088663-100088685 GAACATGCAGGAATGTAGTTTGG + Intergenic
1112839707 13:103561186-103561208 TTAAATGCAGAAATGCTTTTGGG - Intergenic
1112851297 13:103709455-103709477 TTAAATGCAGAAAGGCATTTTGG - Intergenic
1113078118 13:106488496-106488518 GAAAATGCATGATTTCACTTTGG + Intergenic
1113518664 13:110922350-110922372 GTAAATTCATAAAGGCACTTGGG - Intergenic
1114813032 14:25923686-25923708 TAGAATACAGAAATGCAGTTGGG + Intergenic
1115224700 14:31090376-31090398 GAAAATTCAGAAAGGCTCTTAGG + Intronic
1115228344 14:31128977-31128999 GAAAATGCTGAAAGGAAGTTAGG - Exonic
1115320023 14:32069696-32069718 GAAAATGCAGAAATGTGAATTGG + Intergenic
1115913649 14:38285143-38285165 AAAAATGCTGAAATGAACATAGG - Intergenic
1116224104 14:42126093-42126115 GAAAATGTACATATGCACTATGG + Intergenic
1116224108 14:42126178-42126200 GAAAATGTACATATGCACTATGG + Intergenic
1116741535 14:48761227-48761249 GAAAATGCAGAAAATTAGTTGGG - Intergenic
1117132413 14:52699050-52699072 AATAATGCAGAAATGAACATGGG + Intergenic
1117168466 14:53065773-53065795 TAAAATGGAGATATGCACTAAGG - Intronic
1120265705 14:82248229-82248251 GAAAATGTCAAAATGCAATTTGG + Intergenic
1120646109 14:87076213-87076235 CAAAATGAAGAAATTAACTTGGG + Intergenic
1122187418 14:100010926-100010948 GAGAATGCAGAGAGGCACTGAGG + Intronic
1122902291 14:104786892-104786914 GAGAATGCAGAGAGGCCCTTCGG - Intronic
1123715989 15:23031969-23031991 GAAGATGAAGAAATGGACATTGG - Exonic
1124052742 15:26213689-26213711 GAAAATGAAAAAATGTAGTTGGG + Intergenic
1125376114 15:39031472-39031494 GAAACTGCACAAATCCACGTGGG + Intergenic
1125438578 15:39675458-39675480 GAAAATGCAGAAATAAATTTAGG + Intronic
1125911697 15:43445616-43445638 GAAAATGCAGATACCTACTTGGG + Intronic
1126129841 15:45329756-45329778 GAGTATGCAGAAATGGAATTCGG + Intergenic
1126982437 15:54259283-54259305 GAAAATGTACTAATACACTTGGG - Intronic
1127502284 15:59565420-59565442 AAAACCGCAGAAATGCAGTTGGG - Intergenic
1127675393 15:61233327-61233349 GAAAATGCAGCACTGCTCTTGGG + Intergenic
1128334326 15:66776373-66776395 GAAAATTCAGAGATGGACTGTGG + Intronic
1129024839 15:72561344-72561366 GTAAATACTGAAATGCACATAGG - Intronic
1129693316 15:77725944-77725966 GAAAATGAAGTTTTGCACTTGGG - Intronic
1129838457 15:78728409-78728431 GAAAAAGCATTAATGTACTTAGG + Intergenic
1130061521 15:80573843-80573865 GCAAATTCAGAAAAGCAGTTGGG - Intronic
1130246934 15:82260711-82260733 GAAAATGGAGATCTGAACTTAGG + Intronic
1130260129 15:82348162-82348184 GAAAATGCATTAATGTACTTGGG - Intronic
1130268601 15:82431271-82431293 GAAAATGCATTAATGTACTTAGG + Intronic
1130281103 15:82520846-82520868 GAAAATGCATTAATGTACTTAGG + Intergenic
1130472474 15:84237026-84237048 GAAAATGCATTAATGTACTTAGG + Intronic
1130479966 15:84351597-84351619 GAAAATGCATTAATGTACTTAGG + Intergenic
1130491804 15:84436532-84436554 GAAAATGCATTAATGTACTTAGG - Intergenic
1130503419 15:84515572-84515594 GAAAATGCATTAATGTACTTAGG - Intergenic
1130594771 15:85241663-85241685 GAAAATGCATTAATGTACTTAGG + Intergenic
1131754865 15:95548862-95548884 GAGAATGGAGAAAAACACTTGGG + Intergenic
1131755486 15:95556451-95556473 GAAAATGCTTAAATGCACATAGG - Intergenic
1131926075 15:97385358-97385380 GAGAATGCACAAATACACTTGGG - Intergenic
1134514792 16:14878331-14878353 AAAAATACAGAAATGTAGTTGGG + Intronic
1134702469 16:16276989-16277011 AAAAATACAGAAATGTAGTTGGG + Intronic
1134965074 16:18435126-18435148 AAAAATACAGAAATGTAGTTGGG - Intronic
1134969361 16:18517661-18517683 AAAAATACAGAAATGTAGTTGGG - Intronic
1135431963 16:22392265-22392287 AAAGAAGCAGAAAGGCACTTTGG - Intronic
1135524422 16:23203309-23203331 GAAAATGAAGAAGTGGACGTGGG + Intronic
1135694003 16:24571179-24571201 GAAAATTCAGAAATTCACCAAGG + Exonic
1138778160 16:59750543-59750565 GAAAATGGACAAATACACTCTGG - Intronic
1139316283 16:66072113-66072135 GAAACTCCAGAAATGTACATAGG + Intergenic
1140413404 16:74755438-74755460 AAAACAACAGAAATGCACTTTGG - Intronic
1140789751 16:78380102-78380124 GAAACTGGAGAAGTGTACTTGGG + Intronic
1141506252 16:84480464-84480486 GAAAATGCAGAAAGGCCCCCAGG + Intronic
1141531658 16:84650194-84650216 GAAGATGCAGAGAAGCACTTGGG + Intronic
1146449044 17:32957454-32957476 GAAAATGGAGAAATACATTGTGG - Intergenic
1146738360 17:35259327-35259349 GCAAATGCAGAAACACACTTCGG - Exonic
1146757370 17:35444968-35444990 GCAAATGCAGAGATGTACTCTGG + Exonic
1148034268 17:44646717-44646739 GAAAAAGTAGAAAAGCAATTAGG + Intergenic
1148536905 17:48446716-48446738 GAAAACACAGAAATAAACTTAGG - Intergenic
1149051860 17:52314425-52314447 GAATATGCAGCAATGAACATGGG - Intergenic
1149889479 17:60373922-60373944 AAAAATGAAGACATACACTTTGG + Intronic
1150723822 17:67635727-67635749 GAAAACACAGAAATGCACCAAGG + Intronic
1150915740 17:69435162-69435184 GAAAATGGAAAAATGCATTTTGG - Intronic
1150928238 17:69556685-69556707 GAAAATGGAGAAAGGAAATTGGG + Intergenic
1151004750 17:70421465-70421487 CAAAAGCCAGAAATGCACTGAGG - Intergenic
1151951504 17:77356715-77356737 GACAATGGAGAAAGGCAGTTGGG - Intronic
1153130330 18:1848597-1848619 GAAAAAGCAGAAATGGACCTGGG - Intergenic
1153235793 18:2985977-2985999 GAAAATGCAGAAATGCACTTAGG - Intronic
1153489970 18:5636627-5636649 AAAAATACAGAAATGTATTTAGG + Intergenic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1156528632 18:37793724-37793746 GAAAATAAAGAAATGCAAATAGG - Intergenic
1157522336 18:48353887-48353909 GAAAATGCAGGATGGCCCTTTGG - Intronic
1157552416 18:48590725-48590747 GAAAAAGCAGACATCCATTTCGG + Intronic
1157800397 18:50615762-50615784 GAAAAAGCAGAACTGAACTTGGG - Intronic
1157999924 18:52606190-52606212 GAAGAAACAGAAATGCATTTTGG + Intronic
1158019301 18:52822550-52822572 GAAAACGCAGAATTGGAATTTGG - Intronic
1158748879 18:60235469-60235491 AAAAATGCTGAAAAGCATTTTGG - Intergenic
1158892808 18:61888948-61888970 GAAAATATAGAAATGCATTTTGG + Intronic
1159653651 18:71006286-71006308 GAAAATACTGAAAAGCATTTTGG - Intergenic
1159734124 18:72073313-72073335 GAAAATGGAGTGATGCATTTTGG + Intergenic
1159960792 18:74554610-74554632 GAAGATTCAGCAATGCATTTGGG + Intronic
1160555699 18:79723622-79723644 GATAATGCAGAGAGGCCCTTTGG + Intronic
1161630094 19:5349825-5349847 AAAAATACAAAAATGCATTTTGG - Intergenic
1161952942 19:7477714-7477736 CAGAAAGCACAAATGCACTTTGG + Intronic
1162260691 19:9531475-9531497 GAAAAAGCAGAAAGACATTTGGG + Intronic
1164577242 19:29412706-29412728 GAAAATGGACTAATACACTTGGG + Intergenic
1167929079 19:52849035-52849057 GAAAATGCAAAAATACACAAGGG + Intronic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925325264 2:3014686-3014708 GAAAATGAACAAAGACACTTTGG + Intergenic
925435097 2:3830202-3830224 GAAACTGCAGAGATGCATTTAGG - Intronic
925543220 2:4989146-4989168 GAAATTGGAGAAACACACTTAGG - Intergenic
925772017 2:7291449-7291471 GTAAATTCTGAAATACACTTTGG + Intergenic
926165052 2:10517049-10517071 GAGAATGCAAAAATTTACTTCGG + Intergenic
926493284 2:13552487-13552509 GAAAATGCAAATATGCACAATGG + Intergenic
927526768 2:23750360-23750382 GTAAATGCAAAGAAGCACTTTGG + Exonic
927786495 2:25978692-25978714 GAAAATGCAATAACACACTTCGG - Intronic
928594155 2:32844659-32844681 AAAAATGTGGAAATGGACTTTGG + Intergenic
928691750 2:33806734-33806756 AAAAATGCAGAAATGTGCTCTGG + Intergenic
930312967 2:49764911-49764933 AAAAATGAAGAAATGTATTTGGG + Intergenic
931872816 2:66479718-66479740 GACATTCCAGAAATGCACTGGGG + Intronic
931926666 2:67080767-67080789 GAAAACACAGATAAGCACTTGGG - Intergenic
933373907 2:81454021-81454043 GAAAGTGCACAAATGTCCTTTGG + Intergenic
933435123 2:82239688-82239710 GGAAATGCACACATGGACTTTGG - Intergenic
933847215 2:86336330-86336352 GACAATGCTGAGATCCACTTCGG + Intronic
935712336 2:105910302-105910324 TAAAATGCATAATTGAACTTAGG - Intergenic
938011547 2:127832848-127832870 GACAGTGCAGACATCCACTTTGG + Intergenic
939553540 2:143645131-143645153 GAACAGGCAAAAATGAACTTTGG + Intronic
940220956 2:151350834-151350856 GAAAATACAAAAATGAACCTGGG + Intergenic
941649346 2:168076894-168076916 GCAAATGCTGAAGTGCATTTTGG - Intronic
942436141 2:175979118-175979140 GAAAATGGAGAGATACATTTGGG + Intronic
942853706 2:180521309-180521331 GCAAATCCTGAAATGCACGTAGG + Intergenic
943148510 2:184078148-184078170 GAAAATATAAAAATGTACTTTGG + Intergenic
943201907 2:184838046-184838068 GAACATGCAGGAGTGCACGTGGG + Intronic
943573342 2:189600851-189600873 GAATAAGTAGAAATGCTCTTCGG - Intergenic
943857058 2:192809301-192809323 GAAAATGTGGGAATGCACTGTGG - Intergenic
944319428 2:198320934-198320956 AAAAATCTAGAAATGCATTTTGG + Intronic
944323207 2:198372998-198373020 CAAAATGCAGTATTGCATTTTGG - Intronic
944837798 2:203597266-203597288 GAGAATTCAGAAAGGCACTAGGG - Intergenic
944946493 2:204692953-204692975 GGAAATGCAGAAATGGACTCAGG - Intronic
945358039 2:208861503-208861525 GAAAATGGACTAATACACTTGGG + Intergenic
945654413 2:212605599-212605621 GAACATGCAGTAATTGACTTGGG - Intergenic
946586543 2:221195033-221195055 GAAAGTGCAGGAATGCACAATGG + Intergenic
947693755 2:232164748-232164770 GAAAATCCAGCAATGCAATATGG - Intronic
947805130 2:232961269-232961291 GAGAATGCCGAAAGGGACTTGGG - Intronic
948176298 2:235946137-235946159 TAAAATGCAGATAAGCTCTTTGG + Intronic
1169810195 20:9602030-9602052 TAAACTCCAGGAATGCACTTTGG + Intronic
1169835163 20:9869872-9869894 AAAAATGAAGAAATGGACATAGG + Intergenic
1169954552 20:11086721-11086743 GAATCTGCAAAAAAGCACTTTGG + Intergenic
1172909968 20:38401346-38401368 GAAAATGGACAAATACACTATGG - Intergenic
1173425205 20:42936616-42936638 CAAAATGCAGGAATTCACTGAGG + Intronic
1173850957 20:46217622-46217644 GCCCATGCAGAAATGCACATGGG + Intronic
1175552315 20:59825597-59825619 CAAAATACACAAATGCACTGGGG + Intronic
1177004183 21:15650908-15650930 AAAAGTACAGAAATGCAATTTGG + Intergenic
1177756077 21:25349789-25349811 AAATATGCAAATATGCACTTAGG + Intergenic
1180570065 22:16706431-16706453 GTAAATGCAGAAACACATTTGGG + Intergenic
1181683020 22:24508894-24508916 AAAAAGAAAGAAATGCACTTGGG + Intronic
1181853626 22:25767444-25767466 TGAGATGTAGAAATGCACTTTGG - Intronic
1184167144 22:42736427-42736449 GAAAATTTAAAAATGCATTTTGG - Intergenic
1184972171 22:48031699-48031721 GAAAAAGTAGAAACACACTTTGG - Intergenic
949756397 3:7415999-7416021 TAAAATGAAGAAATGGACATTGG + Intronic
949824484 3:8151042-8151064 AAAGAGGCATAAATGCACTTTGG - Intergenic
950758350 3:15197025-15197047 AAAAATTCTGAAATGCAGTTTGG + Intergenic
955132106 3:56180366-56180388 GATAATGCAGCTATGAACTTGGG - Intronic
955641984 3:61095710-61095732 GAAAAAGCAGAATGGCACTGAGG - Intronic
955677835 3:61467732-61467754 AAAAATACAGGAATGCACTTGGG - Intergenic
957278711 3:78122581-78122603 GAAAGTGCAGGAATGCAGCTGGG - Intergenic
957572496 3:81965557-81965579 GCAAATGAAGAAATGTACCTGGG + Intergenic
957977019 3:87459646-87459668 GAACATGCAGAAATGGAAGTTGG + Intergenic
958255775 3:91323227-91323249 GAAAATGGATAAATGGACTATGG + Intergenic
959177177 3:102928257-102928279 TAAAAAGCAGATATGCACTAGGG - Intergenic
959974652 3:112445078-112445100 GAACATGCAGAACTGGAGTTAGG - Intergenic
960581278 3:119281252-119281274 GGAAATGCAATAATGGACTTGGG + Intergenic
960774504 3:121233797-121233819 AGAATTACAGAAATGCACTTTGG + Intronic
961391802 3:126556480-126556502 GCAAGTGCAGAGCTGCACTTGGG - Intronic
962727311 3:138243707-138243729 GAAGATGGAGAAATTCAGTTGGG - Intronic
963329208 3:143895223-143895245 GAATATGCAGTACTGAACTTTGG + Intergenic
963340956 3:144032894-144032916 GAAGATCAAGCAATGCACTTAGG - Intronic
964217456 3:154302580-154302602 GAAAATACAGAACTACAGTTAGG + Intronic
965749554 3:171961693-171961715 GCAAATACAGAAATGAACTGGGG + Intergenic
967032753 3:185623561-185623583 AAAAATCCAGAAAGCCACTTTGG + Intronic
967801261 3:193663175-193663197 GTAAATGGAGAAATTTACTTTGG + Intronic
969257641 4:6013462-6013484 GAAAATGACGAATTTCACTTTGG + Intergenic
969939007 4:10711887-10711909 GAAATTTCAGAAATACTCTTGGG + Intergenic
970518061 4:16853676-16853698 GAAAATGCTGCAATGAACATGGG - Intronic
971030074 4:22626514-22626536 GAATATGCATTATTGCACTTAGG + Intergenic
971250246 4:24968411-24968433 GACATTGCAGACATCCACTTTGG + Intronic
971279261 4:25228393-25228415 GAATATTCAGAAGTGCTCTTAGG - Intronic
971364736 4:25968649-25968671 GAAACTGCAGAAGAGGACTTGGG - Intergenic
971364911 4:25969952-25969974 GAAAATACAGAAAAGCACAAAGG + Intergenic
971432703 4:26584708-26584730 GAGAAAGCAGAAAGGTACTTGGG - Intronic
972863154 4:43196792-43196814 GAAAACTCAGAAATGCAGATAGG + Intergenic
973263720 4:48189507-48189529 GAAAATGCAGAAATAGACAATGG + Intronic
973343843 4:49032969-49032991 GCAAACACAGTAATGCACTTTGG - Intronic
974250235 4:59375895-59375917 GAACATGCAGAAATGGGCCTTGG - Intergenic
975089756 4:70388098-70388120 GAAAATACACAAATGCTCTGGGG - Intronic
975749392 4:77507443-77507465 GTAAATGCAGAAATGAAGTGTGG + Intergenic
975897610 4:79112790-79112812 AAAAATGCAGAACTTCACTGGGG + Intergenic
976210962 4:82669256-82669278 CAAAATGGAGAAATACACTTAGG + Intronic
977008281 4:91600918-91600940 GATCATGCAGATATACACTTTGG + Exonic
978597648 4:110395674-110395696 GAAAGTTCAGAAATGCAGCTTGG - Intronic
979155321 4:117380242-117380264 TAAAATGGATAAATGCACTCTGG + Intergenic
979293747 4:119006512-119006534 GAAAATAAAGGAATGCATTTTGG + Intronic
979919973 4:126484158-126484180 GAAAATACGGCACTGCACTTGGG - Intergenic
980454099 4:133016741-133016763 TAAAATGCAGAAAAGCATTCAGG + Intergenic
980851881 4:138393149-138393171 GAAAAAGCAGAGATGCCCATGGG + Intergenic
981310624 4:143294607-143294629 GCAAAAGAAGAAATGGACTTTGG - Intergenic
982364693 4:154563804-154563826 AAAAATACAGAAATGCATTTAGG + Intronic
983195430 4:164801021-164801043 GAAAAAGTAGAAATTAACTTCGG - Intergenic
983549109 4:168996281-168996303 GAAAATGAAGAGAGGCTCTTTGG - Intronic
983772537 4:171569721-171569743 GAAAATGGACTAATACACTTGGG - Intergenic
984194835 4:176646546-176646568 GAAAGTGCAGAAATTCACACAGG + Intergenic
986736884 5:10674621-10674643 GAGAATGCAGAGGTGCAATTGGG + Intergenic
987254072 5:16131238-16131260 TAACATGCAGCAATGCAGTTTGG + Intronic
987327647 5:16827043-16827065 GAAAAGGCAGATTTGCAGTTAGG - Intronic
987600455 5:20061967-20061989 GAACATTCAGTAATGCACTTAGG - Intronic
987715463 5:21563613-21563635 GATGATGCAGCAATACACTTCGG - Intergenic
988908392 5:35813855-35813877 AAAAATACAGAACTGCATTTAGG - Intronic
990458581 5:56012881-56012903 GCAAATACAGAAAAGGACTTTGG + Intergenic
990604151 5:57391283-57391305 AAAAATAAAGAAAAGCACTTTGG - Intergenic
990666780 5:58081445-58081467 GAAAAAGAAGAAATGCACGTGGG + Intergenic
991259019 5:64646691-64646713 AAAAATGCAGAAAATGACTTTGG - Intergenic
991333648 5:65522182-65522204 GAAACTGCATAAATGTACTCTGG - Intronic
992954965 5:81898964-81898986 GAAAATGCATATATACACTATGG + Intergenic
993621227 5:90169971-90169993 CAAAATGGAGAAATGGACTTTGG - Intergenic
994820118 5:104638790-104638812 AAAAATGATGAAATGCACTGGGG + Intergenic
995318714 5:110805922-110805944 GATAATGCAGAAATACTTTTAGG - Intergenic
996055711 5:118980027-118980049 GAAAATGAAGAAATGAACATTGG - Intronic
996834043 5:127771558-127771580 GAAAATGCAGAAGTGGATTGGGG + Intergenic
997230831 5:132241620-132241642 GAAAATGCAGAAATCCCAATAGG - Intronic
998644462 5:144046858-144046880 GACTATTCAGAAATGCACTCAGG - Intergenic
998782348 5:145671976-145671998 GAAAATAAAGTAAAGCACTTGGG - Intronic
998889568 5:146731472-146731494 GAATATACAGAAATGCAAGTTGG - Intronic
1000078665 5:157821906-157821928 GAAAATGAGTAAAAGCACTTTGG - Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1004610536 6:17235473-17235495 GAAGATACAGAAATTCACTCAGG + Intergenic
1006620711 6:35362029-35362051 GAAAATACAGATAAGCACTGAGG + Intronic
1008855554 6:56082026-56082048 AAAAATGTAGAAATGCCTTTAGG - Intronic
1008999571 6:57697938-57697960 GAAAATGGATAAATGCACTATGG - Intergenic
1009001261 6:57718431-57718453 GATGATGCAGCAATACACTTCGG + Intergenic
1009567096 6:65323133-65323155 GAAAATGTAGAAAAGCACAAAGG + Intronic
1010761743 6:79731973-79731995 AAAGTTGCAGAAATGCCCTTGGG + Intergenic
1010916558 6:81626135-81626157 GGAAATGTAGAAATGCTCCTGGG - Intronic
1011208175 6:84924021-84924043 GAAAGAGATGAAATGCACTTTGG - Intergenic
1012006517 6:93719584-93719606 GAAAATGGGGTAATGCCCTTAGG + Intergenic
1012963656 6:105649169-105649191 GAAAATGGAGAAATGGTCATGGG - Intergenic
1013132285 6:107244595-107244617 GAATATGAAGAATTGCACTTTGG - Intronic
1013970410 6:116011495-116011517 GAAAATGCAGAAAGGAAACTGGG + Intronic
1014578007 6:123098161-123098183 TAAAAAGCAGAAATGTATTTGGG - Intergenic
1016216062 6:141604988-141605010 GAAAATGATGTAATGGACTTTGG - Intergenic
1016688650 6:146910427-146910449 GAAAATGCAGTAACTCATTTAGG - Intergenic
1016817595 6:148317810-148317832 AAAAAGGCAGCAATGCACTATGG - Intronic
1017004108 6:150017292-150017314 GAACATGAAAAAATGCTCTTTGG - Intergenic
1018978775 6:168585431-168585453 GAAAATGCAGAAATAAGCTGTGG - Intronic
1019776848 7:2916688-2916710 GTAAATGCAGAAACACTCTTTGG - Intronic
1020849807 7:13338117-13338139 GAAAATACAGGAATTCACTAAGG - Intergenic
1020946597 7:14617156-14617178 GAAAAGGCAGACATGAATTTGGG - Intronic
1021012038 7:15481753-15481775 GAAAATGCATAAATGCATCAGGG - Intronic
1021821272 7:24500064-24500086 GAGAATGCAGAAAAGCAATTTGG - Intergenic
1022742652 7:33137669-33137691 GAAACTGGAGAGACGCACTTGGG + Intronic
1023674490 7:42616001-42616023 GAAAATGGAGAGATTCATTTTGG - Intergenic
1024162266 7:46688759-46688781 GAAGTAGCAGAAATGGACTTAGG - Exonic
1025813852 7:64891839-64891861 AAAAATGGAGAAATGCACATGGG - Intronic
1025818866 7:64945096-64945118 AAAAATGGAGAAATGCACATGGG + Intergenic
1027471999 7:78585197-78585219 TAAATTGCAGAAATGAATTTAGG - Intronic
1028683109 7:93561416-93561438 GAAAAAGCAAAAATGCTATTAGG - Intronic
1028889260 7:95968646-95968668 GAAACTGCAGATTTGCACATTGG + Intronic
1028900268 7:96091209-96091231 GAAAATGTGGAAATGTACATCGG - Intronic
1029014218 7:97297711-97297733 AATATTGCAGATATGCACTTTGG + Intergenic
1030332836 7:108291013-108291035 GAAAATGAACAAAACCACTTGGG + Intronic
1030535647 7:110763092-110763114 GAAAATGAAGAAATCCACATTGG + Intronic
1031036027 7:116788838-116788860 GAAAATGCCCAAATGGAGTTTGG + Intronic
1031601336 7:123714275-123714297 GAAAACACAAAAATTCACTTTGG + Intronic
1032292110 7:130597866-130597888 GAAAGTGCAGAAATTGGCTTTGG + Intronic
1032532877 7:132636536-132636558 GAAAATGCCCAAATGCCCTGAGG + Intronic
1032572721 7:133017520-133017542 CCAAATGCAGAAATTGACTTTGG + Intronic
1033348333 7:140542257-140542279 GGAAATGCAGACAAGGACTTGGG - Intronic
1033416368 7:141165106-141165128 CAAAATGCAGAAATTAACATTGG + Intronic
1034173746 7:149083892-149083914 GAAAATGTACATATGCACTATGG - Intronic
1036724893 8:11211163-11211185 GAAAATGAAGGAGTGCAGTTTGG - Intergenic
1037918160 8:22785359-22785381 GGAAATGCAGAGGGGCACTTGGG - Intronic
1039137024 8:34336496-34336518 TAAAATGCAGAAAGCAACTTGGG - Intergenic
1039497230 8:37989512-37989534 GTAAATGGAGAAATACACTGTGG - Intergenic
1039515548 8:38129842-38129864 GAAAATGCATAAACACACTGGGG - Intronic
1040525792 8:48223770-48223792 GAAAATGCAGAAATAAACCCAGG - Intergenic
1040640482 8:49328702-49328724 GAATATGCTGCAATGAACTTGGG + Intergenic
1041130506 8:54694045-54694067 GTAAATGCAGAAAAGGCCTTTGG - Intergenic
1041768777 8:61449963-61449985 GAAAATCTTGAAATACACTTGGG + Intronic
1042288914 8:67146889-67146911 GAAAATTAAAAAAGGCACTTTGG - Intronic
1042712771 8:71736587-71736609 GAAAATGCATACATGAACTTTGG - Intergenic
1043330094 8:79105658-79105680 GGAAATCAAGAAAGGCACTTTGG + Intergenic
1043584065 8:81747248-81747270 GAAAATCTAGAAAAGCAATTTGG - Intronic
1043829132 8:84966682-84966704 GAAAATTGAGAAAAACACTTTGG + Intergenic
1044144563 8:88695833-88695855 GATAATACAGAAAAGCAATTTGG - Intergenic
1044256298 8:90066835-90066857 GAAAATGAATTAATGCAATTAGG + Intronic
1045548209 8:103147277-103147299 GGAAATTCTGGAATGCACTTAGG - Intronic
1046258722 8:111737219-111737241 TAAAATGCAAAAATGCAATAAGG - Intergenic
1046652654 8:116855048-116855070 TAAAATGCAGAAAAGCGCATGGG + Intronic
1046720078 8:117609352-117609374 GAAAAGTCTGAAATCCACTTTGG - Intergenic
1046721187 8:117620724-117620746 GAACATGAAGAAATGCTTTTTGG - Intergenic
1046866296 8:119154417-119154439 GAAACTGCCTAAATGCATTTTGG + Intergenic
1047015612 8:120720162-120720184 GAAAATTCCCATATGCACTTTGG + Intronic
1047860282 8:128958299-128958321 GAATATGCATTTATGCACTTGGG - Intergenic
1049764961 8:144350893-144350915 GAAAAGGCAGAAAGGCCCTGGGG - Intergenic
1049946802 9:604946-604968 GAAAATGGACTAATGCAATTGGG + Intronic
1050244584 9:3675011-3675033 GAAAAAGAAGAAAGGCTCTTGGG + Intergenic
1051281764 9:15448341-15448363 GAAAATACACAAATTCACTATGG - Intronic
1051346809 9:16158939-16158961 TAGGATGCACAAATGCACTTTGG - Intergenic
1052439555 9:28477478-28477500 GAAAATGGAGAATTTCAATTTGG - Intronic
1052701492 9:31942505-31942527 GAAAATGGACTAATACACTTGGG + Intergenic
1052757213 9:32553008-32553030 GATAATGCAAAAATAAACTTGGG - Exonic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053198679 9:36138195-36138217 GAAAATCCACAAATTCCCTTAGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054793053 9:69273718-69273740 GAAAATGCAAAAATATCCTTTGG - Intergenic
1055777412 9:79781413-79781435 CAAAATGCAGATTTACACTTAGG - Intergenic
1056141207 9:83682036-83682058 GAAAATGGATAACAGCACTTTGG + Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056690485 9:88804153-88804175 GAATATGCATAACTCCACTTGGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058352279 9:104039869-104039891 GAAAATGAATGAATGCAGTTTGG + Intergenic
1059794771 9:117681782-117681804 GGATTTGCAGAAATGCACTGTGG + Intergenic
1059833032 9:118119784-118119806 GAGAATGAAGAAATGAACATAGG - Intergenic
1059892625 9:118819714-118819736 AAAAAAAAAGAAATGCACTTAGG + Intergenic
1061323267 9:129845781-129845803 GAAAATGCAGAAAAGCAAAAAGG + Intronic
1061538156 9:131262065-131262087 AAAAATACAAAAATTCACTTTGG + Intronic
1203633150 Un_KI270750v1:88454-88476 GTAAATGAACAAATGCACTGAGG - Intergenic
1185974285 X:4701681-4701703 GAAAATGGACAAATACACTCTGG + Intergenic
1186258511 X:7749694-7749716 GAAAATATAGAAAAGCAATTTGG + Intergenic
1186668173 X:11740454-11740476 GAAAATGGAGAAATGAAATTTGG - Intergenic
1187133431 X:16524971-16524993 GAAAATGGACTAATACACTTAGG - Intergenic
1187723306 X:22174572-22174594 GAAAATTCAGATATGTTCTTGGG - Intronic
1188090994 X:25965303-25965325 GAAAATGCATACAAGCACTATGG - Intergenic
1188421914 X:30000606-30000628 GGAAATGCACAAATGAATTTCGG + Intergenic
1188787366 X:34364623-34364645 GAAAAAATAGAAATGCATTTTGG + Intergenic
1189443555 X:41059298-41059320 GACACTACAGAAATCCACTTAGG + Intergenic
1189448434 X:41103662-41103684 ATAAATGCAGAAATGAAATTAGG - Intronic
1189594734 X:42552064-42552086 GAAAATATAGAAATGCAACTTGG + Intergenic
1193418703 X:81256836-81256858 GTAAATGAAGAACTGGACTTTGG - Intronic
1193459193 X:81770085-81770107 GAAACTGCAGATTTCCACTTAGG - Intergenic
1194754001 X:97715563-97715585 GAACATGCACTTATGCACTTTGG + Intergenic
1194755764 X:97737500-97737522 GAGAATTCAGAAATGATCTTTGG + Intergenic
1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG + Intronic
1195962220 X:110397785-110397807 GAAAAGGAAGTAATGGACTTGGG + Intronic
1197265743 X:124368775-124368797 GAAAATGAAAAAGTGCACTGAGG + Intronic
1197900007 X:131360775-131360797 GAACATGGAGAAAGGCACTGAGG + Intronic
1198226770 X:134652545-134652567 GAAAATTCAGAAGTGGGCTTGGG + Intronic
1198491397 X:137145243-137145265 GAAAATGCAGAAGTGACCTTTGG + Intergenic
1198830109 X:140741439-140741461 CAAATTGCAGAAATGCACATAGG + Intergenic
1200755658 Y:6987771-6987793 GAAAATGGAGAAATCGACCTGGG - Intronic
1201586535 Y:15567307-15567329 GCAACTGCAGACATGCACATGGG - Intergenic
1201975338 Y:19842887-19842909 GCAGATGCAAAAATGCAGTTGGG + Intergenic