ID: 1153236653

View in Genome Browser
Species Human (GRCh38)
Location 18:2994846-2994868
Sequence TGGTTTAAACAGATGGTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153236653 Original CRISPR TGGTTTAAACAGATGGTATA TGG Intronic
904514386 1:31042576-31042598 AGCTCTTAACAGATGGTATAAGG + Intronic
908675595 1:66599949-66599971 TGGGTTACAAAGATGGTATCAGG - Intronic
908869769 1:68595967-68595989 TTGTATAAATAGATGGTTTATGG + Intergenic
909633266 1:77788673-77788695 TTTTTTCAACAAATGGTATAGGG - Intronic
911624905 1:100112640-100112662 TGGTTTCTACAAATGTTATAGGG - Intronic
911775234 1:101802253-101802275 TTGTTTAAAATGATGTTATATGG - Intergenic
913126670 1:115797099-115797121 TTGTTTGAACAGATGGGATTGGG - Intergenic
917700542 1:177576224-177576246 AGGTTTAAACAGAGTGGATAGGG - Intergenic
919171051 1:193954585-193954607 TGGGTTAAACAGTTGGTACCTGG + Intergenic
919953616 1:202390190-202390212 TGTTTTCAACAAATGGTACAGGG + Intronic
921536655 1:216357952-216357974 TGGTTGATATAGATGGTCTAAGG + Intronic
923718526 1:236447765-236447787 TGGTTTAAGCAGATCATAGATGG - Intronic
1063258512 10:4356356-4356378 TGGTTTGAACACATGGTACAAGG - Intergenic
1066287290 10:33980724-33980746 TGGCTGAAACACAGGGTATAAGG - Intergenic
1066538072 10:36412904-36412926 TACTTTAAACAGATGGTGCATGG - Intergenic
1066565935 10:36722137-36722159 TGGTTGAAACAGAGGGAAAATGG - Intergenic
1067846608 10:49728714-49728736 TCTTTTAAACAAATGGTACAAGG + Intergenic
1068371826 10:56126919-56126941 TGGTTTAAAGTGATGGAATTAGG + Intergenic
1069350920 10:67526005-67526027 TGTTTTAAACAGATGATTTAGGG - Intronic
1070098497 10:73362168-73362190 TCTTTTAAACAAATGGTACAAGG + Intergenic
1070584797 10:77755831-77755853 TGGTATAAACAAATAGCATATGG + Intergenic
1070584798 10:77755851-77755873 TGGTATAAACAAATAGTATATGG + Intergenic
1071223561 10:83498799-83498821 TGATTTACACAAATGTTATAAGG - Intergenic
1072962883 10:99945539-99945561 TGCTTTATACAGATCTTATAAGG + Intronic
1073206451 10:101771855-101771877 TGGTTTAAAAAGAGGGTGGAAGG - Intronic
1079805190 11:24922141-24922163 TGATATAAACATATGCTATAGGG - Intronic
1080180735 11:29422905-29422927 TGGTGTAGACAGAGGGAATATGG - Intergenic
1080377840 11:31735117-31735139 TGTTTTCAACAAATGGTATTGGG + Intronic
1083001615 11:59297478-59297500 TGGCTTAAACAGAGGGCTTATGG + Intergenic
1090538508 11:127674169-127674191 TGGTTCAATCAGATAATATATGG - Intergenic
1090735656 11:129610374-129610396 AGGTGTCAACAGATGGGATATGG + Intergenic
1090816439 11:130301082-130301104 GGGTGATAACAGATGGTATAAGG + Intronic
1093760204 12:22901344-22901366 TGTTTTAAACAAATGGTGTTGGG + Intergenic
1093849336 12:24017103-24017125 CGGTTTAAAGAGATGTTAAATGG - Intergenic
1093958424 12:25248828-25248850 TGCTTTTAAGAGATGGTAGATGG - Intronic
1097666368 12:62481855-62481877 TGGTTTACAGAGTTGGTAGAAGG + Intronic
1098126930 12:67306440-67306462 TGTTTTCAACATATGGTTTAAGG - Exonic
1100668431 12:96781829-96781851 TAGTTTAAGAAAATGGTATAAGG + Intronic
1101498001 12:105274292-105274314 TGCTTTAAACAGATAGAAAATGG + Intronic
1101927897 12:108988456-108988478 GTCTTTAAACAGATGGTATTAGG - Intronic
1103776902 12:123372607-123372629 TTGTTTAAACAGATGCTTGAAGG + Intergenic
1103794297 12:123492848-123492870 TTGTTTAAACAGATGCTTGAAGG + Intronic
1104365725 12:128174883-128174905 TGGTTTATAGAGATGCCATAGGG - Intergenic
1105265645 13:18811760-18811782 TTGTTTAAACAGCTGATATTTGG + Intergenic
1105761988 13:23523683-23523705 AGGTTTAAACAGGGGGAATAAGG - Intergenic
1106856214 13:33856134-33856156 TGGTTTTCATATATGGTATAAGG + Intronic
1107116191 13:36748400-36748422 TGATTTTTACATATGGTATAAGG + Intergenic
1108044435 13:46369974-46369996 TGGTTGAAACAGATACTGTATGG - Intronic
1108838897 13:54586925-54586947 TGGTGTAAGCATAAGGTATATGG + Intergenic
1109614870 13:64819629-64819651 TAGGTCAAACAGATAGTATATGG + Intergenic
1110646262 13:77888429-77888451 TGGATTAAAAAGATGTTAGAAGG - Intergenic
1111880194 13:93946536-93946558 TGGTATAAACAAGTGGTATAAGG + Intronic
1112626658 13:101112275-101112297 TGGTTTAAACAAGTGGTAACTGG - Intronic
1113238486 13:108309858-108309880 TGGCTTAAACAGAAAGCATATGG + Intergenic
1113440256 13:110323028-110323050 TGGTTGTAACAGCTGGTATTGGG - Intronic
1116443348 14:44979883-44979905 TGGCTTGAAGAGATGGCATAAGG + Intronic
1116671979 14:47854513-47854535 TATTTTAAACAAATGATATAAGG + Intergenic
1117168323 14:53063446-53063468 TGGCTTATACAGTTGGTTTAAGG - Intronic
1117532789 14:56675578-56675600 AGGTTCCTACAGATGGTATATGG - Intronic
1119761049 14:77152136-77152158 TGGTTTACACAGAGGGTCTGTGG - Intronic
1120027157 14:79599575-79599597 TTGTTGAAATAGATGGTATCAGG - Intronic
1120801530 14:88694093-88694115 TAGTTTCAACAAATGGTCTATGG - Intronic
1121559168 14:94861823-94861845 AGGTTTAAACAGTTGGTCTTTGG - Intergenic
1122528182 14:102404928-102404950 TCTTTTCAACAAATGGTATAGGG + Intronic
1122679765 14:103450030-103450052 TGGTTTAGACTGATGAAATAGGG - Intronic
1123694742 15:22870612-22870634 TGCATTAAAGAGATGGTATGTGG - Intronic
1126508676 15:49439745-49439767 GGGTATTAACACATGGTATAAGG - Intronic
1127809750 15:62554351-62554373 TGGTATCAACAGCTGGTACAAGG - Intronic
1128494369 15:68185123-68185145 TGGATCAAAGAGGTGGTATATGG - Intronic
1128605076 15:69031039-69031061 TGGTTGAAAGTGATGGGATAAGG - Intronic
1129099662 15:73248413-73248435 TGGTTGAAACAGAGTGGATATGG - Intronic
1133474760 16:6109790-6109812 TGGTTTAAAAAGTTGGCTTAAGG + Intronic
1134136823 16:11682194-11682216 TGGTTTAGCCAGAAGGTAAATGG - Intronic
1138310703 16:56021238-56021260 TGTTTTAATCAGATGGGGTATGG + Intergenic
1138334556 16:56242578-56242600 TGTTTTCAACAAATGGTATTGGG + Intronic
1139283614 16:65790795-65790817 TGGTCTAAAGAGATGCTCTAGGG + Intergenic
1141579844 16:84989807-84989829 TGGTTTTAAACCATGGTATAGGG - Intronic
1143230471 17:5349975-5349997 TGCTTTAAAGAGATGGTGTGGGG + Intronic
1145097029 17:20038953-20038975 TGGGTGAAACATATGGTATGTGG - Intronic
1145294501 17:21576974-21576996 TAATTTAAACAAATGGGATAGGG + Intergenic
1146537671 17:33667040-33667062 TGGCTTAAACAGGTGGACTATGG + Intronic
1146834772 17:36101854-36101876 TGATTTTTACAGATGGTGTAAGG + Intergenic
1146849379 17:36209036-36209058 TGATTTTTACAGATGGTGTAAGG + Intronic
1150196999 17:63309584-63309606 TGGTTTAAGAAGATGTTTTATGG + Intronic
1153236653 18:2994846-2994868 TGGTTTAAACAGATGGTATATGG + Intronic
1154422754 18:14249768-14249790 TTGTTTAAACAGCTGATATTTGG - Intergenic
1155803172 18:30134550-30134572 TTGTTTTAATAGATGGAATAAGG - Intergenic
1156819001 18:41347150-41347172 TGGTTTAGACAGATGCTTTCTGG + Intergenic
1164106739 19:22113873-22113895 TGGTTTAAACAAATTGTGGATGG - Intergenic
1165345443 19:35245911-35245933 TGTTTTCAACAAATGGTAGAGGG + Intergenic
926927161 2:17998771-17998793 AGGTTTAAACAAATGGTGGAAGG + Intronic
927132991 2:20076326-20076348 CTATTTAAACAGATGCTATACGG - Intergenic
932323834 2:70841417-70841439 TGGTTTTAAAAAATGGTATCTGG - Intergenic
932615366 2:73228063-73228085 TGGTTTAAAGAGCTGGTGTTTGG - Exonic
937696764 2:124816921-124816943 TGCTTTAAACACATAGAATATGG - Intronic
938563163 2:132492910-132492932 TGGTGTATATATATGGTATATGG - Intronic
939579825 2:143935084-143935106 AGTTATAAACAGATGGTATTTGG + Intergenic
940951097 2:159675676-159675698 TTCTTTAAAGAGATGATATATGG - Intergenic
942629718 2:177942368-177942390 TGGTTTCAATGGATGGTGTAAGG - Intronic
943685847 2:190817330-190817352 TGGCTTAAACAGTAGGTATGTGG - Intergenic
944531966 2:200676297-200676319 TGCTTTAAGAAGATGGTTTAAGG + Intronic
944589978 2:201207944-201207966 TGGTTTAAACAACTGGCATGGGG + Intronic
944673236 2:202013892-202013914 TGGGTTACACAGATAGTACATGG + Intergenic
944684272 2:202104510-202104532 TGGTTTTCACAGAAGGAATATGG + Intronic
946653880 2:221923619-221923641 TGCTTTATACAAATCGTATATGG - Intergenic
947005188 2:225503320-225503342 TGGCCTAAAGAGAGGGTATATGG - Intronic
1170358258 20:15516593-15516615 TGGTTTGAACAGAAGGTAGAGGG + Intronic
1170563779 20:17581514-17581536 TGCTTTATTCAGATGGTAGATGG + Intronic
1172329958 20:34068608-34068630 ATGTTTAAACATATGGTACATGG - Intronic
1172342695 20:34170974-34170996 TGGTGTGAACAGATGGACTAAGG - Intergenic
1174164338 20:48574158-48574180 TGCTTTAAACAGATGGCTTAGGG - Intergenic
1174469779 20:50748871-50748893 TGGTTTAAAATGATGTTTTAAGG + Intronic
1175040068 20:56040706-56040728 TGGTTTAAGCAGATAATAGAAGG + Intergenic
1176850712 21:13910191-13910213 TTGTTTAAACAGCTGATATTTGG + Intergenic
1176965503 21:15207975-15207997 TGATGTAAACAGATAGTTTAAGG - Intergenic
1178293010 21:31385737-31385759 CGTTTTAAACAGCTGGTGTAGGG - Intronic
1181758489 22:25041561-25041583 TGGTTTAAACATCTAGTCTAGGG + Intronic
1181883302 22:25998862-25998884 TCATTTAAACAGGTGTTATATGG - Intronic
1182572994 22:31252873-31252895 TGGGTGACACAGATGGTAAATGG + Intronic
1182949480 22:34358780-34358802 AGATTGAAACAGATGGCATATGG + Intergenic
954509619 3:51111555-51111577 TGATTTTTACATATGGTATAAGG - Intronic
955241393 3:57181703-57181725 TGTTTTAACCAGATGATGTATGG + Intergenic
955615026 3:60798553-60798575 ATATTTAGACAGATGGTATATGG + Intronic
956519039 3:70083470-70083492 TGACTTATACAGATGGGATAAGG - Intergenic
958517008 3:95129813-95129835 TAGGTTAAAAAGATGGCATAGGG + Intergenic
960454872 3:117858975-117858997 AGTTTTAAAAATATGGTATATGG - Intergenic
961671930 3:128538914-128538936 TGGTTCAAACAGATCGCACAAGG - Intergenic
963859493 3:150293873-150293895 TGCTATTAACAGATGGTAGAAGG - Intergenic
967761475 3:193230836-193230858 TGGCTAGAACATATGGTATAGGG + Intergenic
969528129 4:7714515-7714537 TGGTTCTAACAGATGGAATGAGG - Intronic
972168286 4:36313743-36313765 TGGTTTACACAGAGGATATAAGG - Intronic
972184288 4:36509682-36509704 TTATATAAACATATGGTATAAGG - Intergenic
972356565 4:38284615-38284637 TCCTTTAAAAAGATGGGATAGGG + Intergenic
973111103 4:46398961-46398983 TGATTTAAAAAGAAGGGATAAGG + Intronic
973926362 4:55742502-55742524 TGGTGGAAACAGGTGGTATTTGG - Intergenic
974927946 4:68324638-68324660 TGGTTTTAACAGCTGGGTTAAGG - Intronic
977386405 4:96345306-96345328 TGGTATAATCAGAAGGTATTTGG + Intergenic
978454994 4:108879419-108879441 TGAAATAAACTGATGGTATATGG + Intronic
981323066 4:143415154-143415176 TGGTTTCAACAAATGGTGTTAGG - Intronic
982327312 4:154141595-154141617 TTGTTCAAACTGGTGGTATAAGG + Intergenic
982964853 4:161893080-161893102 TTGCTTAACCAGATGGTAAATGG - Intronic
984194862 4:176646980-176647002 AGGTTCACACAGATGATATAGGG + Intergenic
984529216 4:180895524-180895546 TGGTATAATCATATGTTATATGG + Intergenic
985428965 4:189859317-189859339 TGGTTTAAAAAGATGACAAAAGG + Intergenic
988493112 5:31721846-31721868 CGGTTTACAGAGCTGGTATATGG + Intronic
988522264 5:31957022-31957044 TGGTTAAGACAAAAGGTATAAGG + Intronic
989377602 5:40780969-40780991 TGGTTTAAGGAGATGGTTTATGG - Intronic
992279940 5:75163989-75164011 TGCTTTTAACAAATAGTATATGG + Intronic
994256983 5:97608822-97608844 TGTTTTACACAGATTGTAAATGG + Intergenic
994580447 5:101634853-101634875 TCGTTTAAAAAAATAGTATATGG + Intergenic
995267057 5:110174336-110174358 TGGTTTGAGCAAATGGTAGAGGG + Intergenic
995490233 5:112683409-112683431 GGGTTTAACCAGAAGGGATATGG + Intergenic
996392990 5:122983421-122983443 TATTTTATGCAGATGGTATATGG - Intronic
1000684886 5:164236192-164236214 TGGTTTAAACATATGGATTTGGG - Intergenic
1000983822 5:167845570-167845592 TGCTTAAAACAGCTGGCATATGG + Intronic
1002035549 5:176466474-176466496 TAGTATAAACAGATGAGATATGG + Intronic
1002354489 5:178613981-178614003 TGTTTTAAGAAGATGTTATATGG - Intronic
1003373712 6:5553915-5553937 TCGTTCAATCAGATGGTAAAAGG + Intronic
1007883217 6:45190661-45190683 TGTTTTACAAAGATGGTCTATGG - Intronic
1008184523 6:48372498-48372520 TGGATTAAACAGATTGTAGATGG - Intergenic
1011159730 6:84375571-84375593 TGGTTTAAACAAATATTTTATGG - Intergenic
1011671670 6:89689307-89689329 AGGTATAAACAAATGGTGTAGGG + Intronic
1011807598 6:91089716-91089738 TCTTTTAAACAGAGTGTATATGG - Intergenic
1011902037 6:92310942-92310964 AGGTTTAAACAGTTCTTATAGGG - Intergenic
1012779477 6:103539263-103539285 TGTTTTATACAAATTGTATAAGG + Intergenic
1017557745 6:155590385-155590407 TGGTTTTGCCAGATGGAATATGG + Intergenic
1021603497 7:22388170-22388192 TGGTTTTTACAGGTCGTATAAGG + Intergenic
1022150581 7:27599750-27599772 TGTTTTAAACAATTGGTATTTGG - Intronic
1022733004 7:33048805-33048827 AAGTTTAAAAAGATGGGATATGG - Intronic
1022893528 7:34725645-34725667 TGGTGAAAACAGCTGGTATGGGG - Intronic
1024572214 7:50732686-50732708 GGGTGTTAATAGATGGTATAGGG - Intronic
1024932989 7:54684062-54684084 TGGTTTAAGTAGATGGTTTCAGG - Intergenic
1026249013 7:68650807-68650829 TGGGTCAAAGAGATGGTATTTGG + Intergenic
1027482770 7:78719143-78719165 TGGTTCACATAGAAGGTATAGGG - Intronic
1030998208 7:116384333-116384355 TGGTATATGCATATGGTATATGG - Intronic
1031550734 7:123109137-123109159 TGATTTTTACATATGGTATAAGG + Intergenic
1031672030 7:124560944-124560966 TGGATTATACATATGGTATATGG - Intergenic
1032351198 7:131165496-131165518 TGTTTTACACAGAAGGTGTAGGG + Intronic
1032447924 7:132000610-132000632 TGGATAAAATAGATGGTATTAGG - Intergenic
1036392696 8:8338203-8338225 AGGTTAAAACACATGGTACATGG - Intronic
1042054609 8:64750740-64750762 TGGTTTAAACCCAGGGTAGAGGG - Intronic
1042729675 8:71918347-71918369 TGGTTTAAACACATTGGTTATGG + Intronic
1045776747 8:105812900-105812922 TGGTTTTATCAGGTAGTATATGG + Intergenic
1050142736 9:2533244-2533266 TGATTTAAAAATATTGTATAGGG - Intergenic
1051452887 9:17216751-17216773 TGGGTTACACAGCTGCTATATGG + Intronic
1055852462 9:80648886-80648908 TGGTTTAAAAAGTTGGTGTGTGG + Intergenic
1058957351 9:109961372-109961394 TGGTATAAACACATGGTATGGGG + Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188279525 X:28247459-28247481 TGGTAGGAACAGAGGGTATATGG + Intergenic
1188316859 X:28685607-28685629 GGGTTTAATCTGATAGTATAAGG + Intronic
1189976808 X:46469108-46469130 TGATTTAAACACATAATATAAGG - Intronic
1193342891 X:80372184-80372206 TGGTTTAAGGAGATGGTTTAAGG + Intronic
1194528510 X:95012328-95012350 TGTATTCCACAGATGGTATATGG - Intergenic
1196218051 X:113078627-113078649 TGATTCAAACAAATGTTATAAGG + Intergenic
1197103274 X:122681741-122681763 TACTGTAAAAAGATGGTATAAGG - Intergenic
1198039758 X:132838441-132838463 TGGATTAAAGGGATGGTCTAAGG + Intronic
1198232335 X:134702920-134702942 TTCTGTAAACAGATGATATATGG + Intronic
1199526107 X:148793699-148793721 TGGATTGATCAGATGGTTTAAGG + Intronic
1200113651 X:153758995-153759017 TCTTTTCAACAAATGGTATAGGG + Intergenic
1202581039 Y:26380971-26380993 TATTTTCAACAAATGGTATAGGG - Intergenic