ID: 1153237131

View in Genome Browser
Species Human (GRCh38)
Location 18:2999160-2999182
Sequence GGAGTTCAGCGTTTCTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 633
Summary {0: 1, 1: 0, 2: 6, 3: 71, 4: 555}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153237131_1153237137 18 Left 1153237131 18:2999160-2999182 CCAAAAAAGAAACGCTGAACTCC 0: 1
1: 0
2: 6
3: 71
4: 555
Right 1153237137 18:2999201-2999223 AATGTGACCTTATTTGGAAAGGG 0: 77
1: 143
2: 292
3: 474
4: 1448
1153237131_1153237136 17 Left 1153237131 18:2999160-2999182 CCAAAAAAGAAACGCTGAACTCC 0: 1
1: 0
2: 6
3: 71
4: 555
Right 1153237136 18:2999200-2999222 GAATGTGACCTTATTTGGAAAGG 0: 12
1: 12
2: 25
3: 51
4: 228
1153237131_1153237135 12 Left 1153237131 18:2999160-2999182 CCAAAAAAGAAACGCTGAACTCC 0: 1
1: 0
2: 6
3: 71
4: 555
Right 1153237135 18:2999195-2999217 GCTCAGAATGTGACCTTATTTGG 0: 17
1: 439
2: 1035
3: 2168
4: 3049
1153237131_1153237138 19 Left 1153237131 18:2999160-2999182 CCAAAAAAGAAACGCTGAACTCC 0: 1
1: 0
2: 6
3: 71
4: 555
Right 1153237138 18:2999202-2999224 ATGTGACCTTATTTGGAAAGGGG 0: 16
1: 612
2: 1460
3: 2048
4: 3235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153237131 Original CRISPR GGAGTTCAGCGTTTCTTTTT TGG (reversed) Intronic
900484923 1:2918026-2918048 GGACCTCAACGTATCTTTTTGGG + Intergenic
900670716 1:3852686-3852708 GAACTTCAGCGTATCCTTTTGGG - Intronic
900726650 1:4220686-4220708 GGACTTCAACATATCTTTTTTGG + Intergenic
901145684 1:7063043-7063065 GGACTTCAACATATCTTTTTGGG + Intronic
901555918 1:10031394-10031416 GGCTTTGAGGGTTTCTTTTTGGG + Intergenic
902864015 1:19266072-19266094 TGAGTACAGGGTTTCTTTTGGGG - Intergenic
902868897 1:19300662-19300684 TGAGTACAGAGTTTCTTTTGGGG - Intergenic
904496571 1:30890520-30890542 TGGGTACAGCGTTTCTTTCTGGG + Intronic
905049292 1:35035534-35035556 GGACTTCAACATATCTTTTTAGG - Intergenic
905253128 1:36662638-36662660 GGACTTCAGTATCTCTTTTTGGG + Intergenic
905407462 1:37744797-37744819 GGACTTCAACATATCTTTTTTGG - Intronic
906304859 1:44710813-44710835 TGAATTCAGGGTTTCCTTTTGGG - Intronic
906737031 1:48139826-48139848 ATAGTTCAGGATTTCTTTTTAGG + Intergenic
907085295 1:51666959-51666981 GGCTTTCATCGTTTCTTGTTTGG - Intronic
907632891 1:56101744-56101766 GGACTTCAACGTTTGATTTTTGG + Intergenic
908015386 1:59827209-59827231 GGAGTTCAGCCTTTTTCTTAAGG + Intronic
908467228 1:64408400-64408422 GGACTTCAACATGTCTTTTTTGG + Intergenic
909697228 1:78481405-78481427 GGAGTTCAACAAATCTTTTTTGG - Intronic
909838969 1:80293970-80293992 GGACTTCAGCATATCTTTTTAGG - Intergenic
910286576 1:85562434-85562456 GGATTTCAACCTATCTTTTTGGG - Intronic
910657800 1:89635487-89635509 GAAGTTCAGAGTTTCTGATTTGG + Intronic
910957884 1:92727225-92727247 TGGGTACAGAGTTTCTTTTTGGG + Intronic
911140476 1:94496207-94496229 TGAGTACAGAGTTTCTATTTGGG - Intronic
911248377 1:95546277-95546299 GGACTCCAACGTATCTTTTTTGG - Intergenic
911655157 1:100435430-100435452 TGAGTCCAAAGTTTCTTTTTGGG + Intronic
912379849 1:109241408-109241430 GGAGTTCAGGGCTTCTTTCCTGG - Intergenic
912855572 1:113166070-113166092 GGACTTTAACGTATCTTTTTGGG + Intergenic
913929980 1:124945563-124945585 GGAGTTCAACCTTTCTTTTCAGG - Intergenic
913955925 1:143293082-143293104 GCATTTCAGAGTTTTTTTTTGGG + Intergenic
914044579 1:144079920-144079942 GGAGCTTAGAGTTTCATTTTTGG - Intergenic
914075879 1:144349014-144349036 GCATTTCAGAGTTTTTTTTTGGG - Intergenic
914103299 1:144617482-144617504 GCATTTCAGAGTTTTTTTTTGGG + Intergenic
914133531 1:144880766-144880788 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
914887615 1:151598342-151598364 GGAGTTCAGAGTTTCAGTTGGGG - Intergenic
915287421 1:154861837-154861859 GGAGTTCAGCTCCTGTTTTTAGG + Intronic
915481758 1:156191304-156191326 TGGGTTCAGGGTTTCCTTTTGGG - Intergenic
916410644 1:164543708-164543730 GGACTACAGCATATCTTTTTGGG - Intergenic
918745437 1:188193123-188193145 GGACTTCAGCGTATCTTTTTAGG + Intergenic
919138643 1:193542368-193542390 GGATTTCAGGTTTTCTCTTTGGG - Intergenic
920001630 1:202804114-202804136 TGAGTTCAGGGTTTCTTTTGAGG + Intronic
920080011 1:203366207-203366229 GGACTTCAGCCTATCTTTCTGGG + Intergenic
920092123 1:203462255-203462277 GGAGATCAGAGTTTTTTTTTTGG + Intergenic
920566964 1:206981795-206981817 GGACTTCATCATATCTTTTTTGG + Intergenic
921914929 1:220596824-220596846 TGAGTACAGAGTTTCTGTTTTGG - Intronic
922112441 1:222574129-222574151 AGAGCACAGGGTTTCTTTTTAGG + Intronic
922219494 1:223547491-223547513 GGAGTACAGGGTTTCTTTTTAGG + Intronic
922326698 1:224535045-224535067 GGACTTCAACATATCTTTTTTGG - Intronic
922772824 1:228197213-228197235 GGAGTTCAACATATCTTTTTGGG + Intergenic
922985411 1:229862531-229862553 GGAGTACAGAGTTTCAGTTTGGG - Intergenic
923020082 1:230156346-230156368 GAAGTTCACCGTGTCATTTTAGG + Intronic
923493500 1:234505240-234505262 GGACTTCAGCATTTCTTCTTGGG - Intergenic
924599089 1:245472488-245472510 GGACTTCAGATTTTCATTTTAGG - Intronic
924757070 1:246951219-246951241 GGACTTCAGCATACCTTTTTGGG - Intronic
1064385137 10:14883788-14883810 GGGGTTTACTGTTTCTTTTTGGG - Intronic
1064676679 10:17767112-17767134 GGATTTCAACATATCTTTTTGGG + Intronic
1064977334 10:21132098-21132120 TGAGTACTGAGTTTCTTTTTGGG - Intronic
1065158955 10:22899297-22899319 GGACTTCAACATATCTTTTTGGG - Intergenic
1066787395 10:39020272-39020294 AGAGTTAAGCATTTTTTTTTTGG - Intergenic
1066956707 10:42179607-42179629 GGAGCTTAGAGTTTCATTTTTGG - Intergenic
1067176956 10:43956895-43956917 GGACTTCAACCTATCTTTTTGGG + Intergenic
1068176933 10:53472950-53472972 GGAGTTTAGCTTTTATGTTTAGG - Intergenic
1068763866 10:60741568-60741590 TGAGTTCAATGTTTCCTTTTGGG - Intergenic
1068813995 10:61289159-61289181 TGGGTACAGAGTTTCTTTTTGGG + Intergenic
1069029951 10:63585113-63585135 GCAGTTCAGAGTTACTTGTTGGG + Intronic
1069087172 10:64154678-64154700 GGACTTCACCGTATCTTTTTGGG - Intergenic
1069403859 10:68077169-68077191 GGACTTCAGCTTATCTTTTGAGG + Intergenic
1070308231 10:75252904-75252926 GGACTTCAGCATATCTTTTGGGG + Intergenic
1071470334 10:85979705-85979727 GGATTCCAGCTTATCTTTTTGGG + Intronic
1071756999 10:88554173-88554195 CAAGTTCAGCTTTTTTTTTTTGG - Intronic
1072177351 10:92941044-92941066 TGAGTACAGAGTTTCTATTTGGG - Intronic
1072338314 10:94420490-94420512 TGAGTACAGAGCTTCTTTTTGGG - Intronic
1072822708 10:98574004-98574026 GGGATGCAGGGTTTCTTTTTGGG - Intronic
1072894245 10:99352094-99352116 TGAGTACAGAGTTTCTTTTGGGG - Intronic
1074726791 10:116319325-116319347 GGACTTCAACATTTCTTTTGGGG - Intergenic
1075177666 10:120180973-120180995 GCAGTTCAGTCTTTCTTTTCTGG + Intergenic
1075462694 10:122628854-122628876 TGAGTACAGGGTTTCTTTTTGGG + Intronic
1075669802 10:124256603-124256625 TGACTTCAGCGTATCTTTCTGGG - Intergenic
1075769891 10:124924448-124924470 TGAGTACAGAGTTTCTTTTTGGG - Intergenic
1076050406 10:127329101-127329123 GGAGTTGAGAGTTTCTGCTTGGG - Intronic
1076431766 10:130408855-130408877 GGAGTTCTGGGGTTCTGTTTGGG + Intergenic
1077645542 11:3920329-3920351 TGGGTGCAGTGTTTCTTTTTAGG - Intronic
1078150434 11:8754894-8754916 GGAGTACGGGGTTTCTTTTTGGG + Intronic
1078478663 11:11657063-11657085 GGACTTCAACATATCTTTTTTGG - Intergenic
1079054020 11:17189654-17189676 TGAGTGCAGGGTTTCTTTATGGG - Intronic
1079190811 11:18275361-18275383 GGTGTTCGGAGTTTCTTTTCTGG + Intergenic
1079215928 11:18511755-18511777 TGAGTACAGGGTTTCTTTTTCGG - Intronic
1079311746 11:19372650-19372672 GGAGGTCAGCCTTTCTGTTTGGG - Intronic
1079403618 11:20126335-20126357 GGACTTCAACCTGTCTTTTTGGG - Intergenic
1079561223 11:21822032-21822054 GGATTTGAACATTTCTTTTTAGG - Intergenic
1079979400 11:27133009-27133031 TTAGTTCAGGTTTTCTTTTTAGG - Intergenic
1080224127 11:29941138-29941160 CAAGTTCAGTGTTTATTTTTTGG - Intergenic
1080562886 11:33480204-33480226 AGAGTACAGGGTTTCTTTTGGGG - Intergenic
1082860846 11:57854858-57854880 AGAGTACAGGGCTTCTTTTTGGG + Intergenic
1083373330 11:62199227-62199249 GGGGTACAGAGTTTCTGTTTGGG + Intergenic
1083479801 11:62936519-62936541 AGAGTTGGGGGTTTCTTTTTAGG + Intronic
1084092049 11:66885146-66885168 GGACTTCAGTGTATCTTTTTTGG - Intronic
1085142128 11:74155761-74155783 TGGGTACAGTGTTTCTTTTTGGG + Intronic
1085191121 11:74623509-74623531 TGGGTTCAGGGTTTCTTTCTGGG + Intronic
1086999541 11:93400606-93400628 GGATTTCAACATGTCTTTTTGGG + Intronic
1087156168 11:94906837-94906859 TGAATACAGAGTTTCTTTTTAGG + Intergenic
1087634578 11:100687696-100687718 GGAGTTCAGCGATTCCTACTTGG + Exonic
1089147708 11:116342155-116342177 GGGGGTCAGCGGTTCTGTTTGGG + Intergenic
1089209963 11:116793000-116793022 GGAGTTCAGCTTTTCCTCATGGG - Intergenic
1089653573 11:119931244-119931266 GGATTTCAATGTTTCTTTTGGGG + Intergenic
1089824072 11:121256982-121257004 TGAGTTCAGAGTTTATGTTTAGG + Intergenic
1089829759 11:121316696-121316718 GGAGTTCAGGGTTTATTATAGGG - Intergenic
1089898311 11:121954893-121954915 GGAATTCAACCTATCTTTTTAGG - Intergenic
1090743561 11:129689320-129689342 TGAGTACAGAGTTTCTGTTTGGG + Intergenic
1091097150 11:132834795-132834817 GGACTTCAACATATCTTTTTGGG + Intronic
1091631173 12:2162102-2162124 GGGGTTCAGGGTTTAGTTTTGGG + Intronic
1091723259 12:2828282-2828304 GGGGGACAGGGTTTCTTTTTGGG - Intronic
1092082630 12:5730004-5730026 TGGGTACAGGGTTTCTTTTTCGG + Intronic
1092149838 12:6240212-6240234 TGAGTACAGAGTTTCTGTTTGGG + Intergenic
1092168601 12:6359119-6359141 TGGGTACAGGGTTTCTTTTTGGG + Intronic
1092516845 12:9223619-9223641 GGACTTCAACATATCTTTTTTGG + Intergenic
1094557800 12:31519912-31519934 GAGGTGCAGGGTTTCTTTTTGGG - Intronic
1094582027 12:31742173-31742195 GAGGTACAGAGTTTCTTTTTGGG + Intergenic
1094642810 12:32292457-32292479 GGACTTCAACATGTCTTTTTTGG + Intronic
1094706275 12:32916931-32916953 GGGATTCAGAATTTCTTTTTCGG + Intergenic
1095256609 12:40044342-40044364 GGAGTGCAAGGTTTCTTTTTAGG + Intronic
1096912825 12:55001165-55001187 GGATTTCAAAGTATCTTTTTTGG + Intergenic
1097702579 12:62835109-62835131 GGAGATCAGCGATGCTTTTTTGG - Intronic
1098718523 12:73863958-73863980 GGAGGTCATAGTTTCTTGTTAGG - Intergenic
1099323562 12:81181803-81181825 GAAGTTCACAGATTCTTTTTTGG - Intronic
1099359906 12:81687295-81687317 AGAGTGCAGGGTTTCTTTTTTGG - Intronic
1100150922 12:91736481-91736503 GGAATTCAACATATCTTTTTAGG - Intergenic
1101771057 12:107751387-107751409 TGTGTTTAGCCTTTCTTTTTTGG - Intronic
1101973539 12:109334904-109334926 TGGGTACAGGGTTTCTTTTTGGG - Intergenic
1102013572 12:109633607-109633629 GGACCTCAACGTATCTTTTTAGG - Intergenic
1102193936 12:111010788-111010810 AGAGTACAGAGTTTCTGTTTGGG + Intergenic
1102271295 12:111537726-111537748 GGGGTTCAGAGTTTCTTTTCAGG + Intronic
1102442350 12:112973114-112973136 GGGTTTCAGGGTTTCCTTTTAGG - Exonic
1102821985 12:115916226-115916248 GGGGTACAGGGTTTCCTTTTGGG + Intergenic
1103295732 12:119885148-119885170 TGTGTACAGAGTTTCTTTTTGGG + Intergenic
1103679330 12:122680792-122680814 TGGGCACAGCGTTTCTTTTTGGG + Intergenic
1103806393 12:123576939-123576961 TGGGTACAGGGTTTCTTTTTTGG + Intergenic
1103987095 12:124774751-124774773 GGAGCTCTGCGTTTCACTTTTGG - Intergenic
1104005094 12:124886197-124886219 GGGCTTCAGCATATCTTTTTGGG + Intergenic
1104022390 12:125001853-125001875 TGGGTACAGAGTTTCTTTTTGGG - Intronic
1104423217 12:128654093-128654115 GGACTTCAGCATATCTTTTGGGG - Intronic
1105412352 13:20181367-20181389 TGAGTACAGCGTTTCTATTTGGG - Intergenic
1105592349 13:21804789-21804811 GAAGTATAGCATTTCTTTTTGGG + Intergenic
1106286168 13:28319814-28319836 GGAGTGCAGGCTTTCTTTGTGGG - Intronic
1107422157 13:40257526-40257548 GGACTTCATCCTGTCTTTTTGGG - Intergenic
1107681031 13:42850679-42850701 GGACTTGAACGTATCTTTTTTGG + Intergenic
1108324827 13:49319468-49319490 TGAGTACAGGGTTTCCTTTTGGG + Intronic
1108555787 13:51590923-51590945 GGAGATGACCTTTTCTTTTTTGG - Intronic
1109018643 13:57055208-57055230 GAACTTCAGTGTATCTTTTTAGG - Intergenic
1110093821 13:71489661-71489683 GGATTCCAGTTTTTCTTTTTAGG - Intronic
1110095365 13:71512079-71512101 CAATTTCAGCATTTCTTTTTTGG + Intronic
1110141870 13:72140101-72140123 GGACTTCAGCATGTCTTTTTGGG + Intergenic
1110509221 13:76329110-76329132 GGACTTGAACATTTCTTTTTGGG + Intergenic
1110797849 13:79660555-79660577 TGGGTTTAGGGTTTCTTTTTGGG + Intergenic
1112089466 13:96067863-96067885 GAACTTCAGCATATCTTTTTGGG - Intergenic
1112097622 13:96152015-96152037 GGACTTCAATGTATCTTTTTTGG + Intronic
1112287379 13:98116304-98116326 GGATTTCAGCATATCCTTTTGGG - Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1112650561 13:101391931-101391953 GGAGTGCAGTGGTTCATTTTCGG - Intronic
1113093169 13:106636080-106636102 GGACTTCAACGTATCTTTTAGGG + Intergenic
1113509513 13:110841780-110841802 GGACTCCAGCATGTCTTTTTGGG + Intergenic
1113594887 13:111524130-111524152 GGACTTCAACATATCTTTTTAGG - Intergenic
1113866605 13:113530236-113530258 TGGGTACAGGGTTTCTTTTTGGG + Intronic
1115118058 14:29906531-29906553 AGAGTTTAGCTTTTTTTTTTTGG - Intronic
1115553787 14:34527829-34527851 ACAGTACAGCGTTTCCTTTTGGG + Intronic
1116402240 14:44522137-44522159 GGACTTCAACGTATCTTTTGGGG - Intergenic
1116447946 14:45033763-45033785 GAAGTTCAGGATTTCTTTTCTGG - Intronic
1116962897 14:50985296-50985318 GGAGTTAAGGGTTTCTAATTCGG + Intronic
1117299869 14:54414220-54414242 GGACTTCAGCATGTCTTTTGGGG + Intronic
1117352403 14:54894130-54894152 GGACTTCAACATATCTTTTTTGG - Intronic
1117828909 14:59731365-59731387 GGGGTGCAGGGTTTCTTTTTGGG + Intronic
1117920124 14:60720926-60720948 AGTGCTCAGCTTTTCTTTTTTGG + Intronic
1118112343 14:62735699-62735721 GGACTTCAACGTATCTTTGTTGG - Intronic
1118591932 14:67408411-67408433 GGACTTCAGTGTATCTTTTTTGG - Intronic
1118715786 14:68558830-68558852 GGACTTCAGTGTATCTTTTGAGG + Intronic
1118805157 14:69229694-69229716 TGATTTCAGCTTGTCTTTTTGGG + Intronic
1121330636 14:93047341-93047363 GGACTTCAGCTTATCTTGTTGGG - Intronic
1121709396 14:96026493-96026515 GGACTTCAACGTATCGTTTTGGG + Intergenic
1121918739 14:97860583-97860605 GGACTTCAGCATATGTTTTTGGG - Intergenic
1202936411 14_KI270725v1_random:92153-92175 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
1124946830 15:34275983-34276005 AGAGTACAGCGTTTCTGTTTGGG + Intronic
1125154777 15:36573372-36573394 GGAGTAGAGGGTTTCTTTTGGGG - Intergenic
1125631768 15:41153080-41153102 ATAGTTCAGGATTTCTTTTTAGG - Intergenic
1125813149 15:42559387-42559409 GTTGTTCATCCTTTCTTTTTGGG + Exonic
1126408470 15:48347398-48347420 GGACTTCAACATATCTTTTTAGG + Intergenic
1126648515 15:50898592-50898614 GGAGTTCAGTGGTGCTATTTGGG + Intergenic
1127126250 15:55814944-55814966 TGAGTTTAGGGTTTCTTTTTGGG - Intergenic
1127296079 15:57609586-57609608 GGACTCCAGCATATCTTTTTGGG + Intronic
1127371022 15:58341418-58341440 TGAGTTCATTGATTCTTTTTTGG + Intronic
1127473391 15:59310302-59310324 GGACTTCAACATGTCTTTTTTGG - Intronic
1128159176 15:65411856-65411878 TGAGTACAGGGTTTCTTTTGGGG + Intronic
1128180013 15:65593875-65593897 AGGGTACAGGGTTTCTTTTTGGG + Intronic
1129018811 15:72495243-72495265 TGAGTATAGGGTTTCTTTTTAGG + Intronic
1130329988 15:82914584-82914606 TGGGTTCAGAGTTTCTGTTTGGG + Intronic
1130692831 15:86099924-86099946 GGATTTCAGTTTTTCCTTTTTGG + Intergenic
1131369223 15:91865820-91865842 GGACTTCAGTTTATCTTTTTGGG + Intronic
1131545958 15:93315625-93315647 GGATTTCAACATATCTTTTTTGG + Intergenic
1131915740 15:97264072-97264094 GGATTTCAACATTTCTTCTTGGG + Intergenic
1133216532 16:4295815-4295837 TGAGTATAGGGTTTCTTTTTGGG + Intergenic
1133935264 16:10264306-10264328 GGACTTGAGCATATCTTTTTGGG - Intergenic
1134449941 16:14357212-14357234 GGATTTCAACATATCTTTTTGGG - Intergenic
1135615894 16:23910783-23910805 GGGGTTCAGGGTTTCTTTCGGGG - Intronic
1136147717 16:28325316-28325338 GGACTTCAGCTTTGATTTTTGGG - Intergenic
1136509300 16:30726005-30726027 CAGGTGCAGCGTTTCTTTTTGGG - Intronic
1136907201 16:34108420-34108442 AGAGTTCAACCTTTCTTTTTTGG + Intergenic
1137631320 16:49947803-49947825 GGACTTCAACATATCTTTTTGGG - Intergenic
1137656694 16:50165547-50165569 TGGGTTCAGAGTTTCTTTCTGGG - Intronic
1137658891 16:50186168-50186190 TGAGTACAGAGTTTCTGTTTAGG - Intronic
1139332051 16:66200618-66200640 TGCATACAGCGTTTCTTTTTGGG + Intergenic
1139332817 16:66207043-66207065 GAACTTCAGCATATCTTTTTAGG + Intergenic
1139532884 16:67551944-67551966 GGGGTGCAGGGTTTCTTTTTGGG - Intergenic
1139946049 16:70642945-70642967 TGAGTTCAGAGTTTATTTTGGGG + Intronic
1140172325 16:72618690-72618712 TGAGTTTAGGGTTTCTTTTTGGG + Intergenic
1140764224 16:78140797-78140819 GGACTTCAACATATCTTTTTGGG + Intronic
1141314558 16:82949473-82949495 GGAGTTGGACGTTTCTTTTAGGG + Intronic
1143285685 17:5787462-5787484 GGTGGTCAACATTTCTTTTTGGG + Intronic
1145180591 17:20747626-20747648 GGATTTCAGCTTTGGTTTTTGGG - Intergenic
1145406019 17:22594831-22594853 GGAGTGCAGTGGTTCTTTCTTGG - Intergenic
1146020932 17:29278169-29278191 TGAGTTCCGAGTTTCTATTTAGG - Intronic
1147512448 17:41082515-41082537 GGAGATCAGAGTTTCATTTCAGG - Intergenic
1147859617 17:43510741-43510763 AGGGTACAGCATTTCTTTTTAGG - Intronic
1148233815 17:45953921-45953943 GGAGTTCTGCTTTTCATGTTGGG - Intronic
1148390081 17:47265671-47265693 GGACTTCAACATATCTTTTTTGG + Intronic
1148777562 17:50104245-50104267 TGAGTTCAGGGCTTATTTTTTGG + Intronic
1148938686 17:51187490-51187512 AGAGTTCAGAGTATTTTTTTTGG - Intronic
1148957263 17:51364116-51364138 GGAGTCTATCATTTCTTTTTGGG + Intergenic
1149805924 17:59618472-59618494 GGACTTGAGCTTTTCTCTTTCGG + Intergenic
1149840188 17:59956608-59956630 GGATTTCAGCTTTGGTTTTTGGG - Intronic
1150033801 17:61771285-61771307 TGAGTTAGGAGTTTCTTTTTGGG + Intronic
1150667232 17:67152592-67152614 GGAATTCAGAATTTCGTTTTGGG + Intronic
1151443994 17:74151451-74151473 GGAGCCCAACGTATCTTTTTTGG - Intergenic
1152048230 17:77953015-77953037 GGACTTCAACATATCTTTTTGGG + Intergenic
1152613430 17:81327112-81327134 TGAGTACAGAGTTTCTGTTTGGG - Intronic
1153237131 18:2999160-2999182 GGAGTTCAGCGTTTCTTTTTTGG - Intronic
1153353410 18:4107515-4107537 GGATTTCAGGGTTTCTTTCTGGG + Intronic
1153630411 18:7063881-7063903 GGGGTACAGAGTTTCTGTTTGGG + Intronic
1153804126 18:8697341-8697363 TGGGTACAGGGTTTCTTTTTGGG - Intergenic
1153976409 18:10271903-10271925 GCTGTTTAGCCTTTCTTTTTGGG + Intergenic
1155528775 18:26744509-26744531 GGACTTCAGCGTATCTTTTTGGG + Intergenic
1156080238 18:33325956-33325978 TGAGTTCAGGGTTTCCCTTTGGG - Intronic
1156167078 18:34434857-34434879 GGACTTCAACATATCTTTTTGGG + Intergenic
1156567020 18:38203507-38203529 AGAGTACAGGGTTTCTTTTTGGG - Intergenic
1156741840 18:40340020-40340042 GGAGTTCAACATATCTTTTGGGG + Intergenic
1157367631 18:47080432-47080454 TGAGTACAGGGTTTCTTTTTGGG - Intronic
1158272193 18:55728706-55728728 GGATTTCAACATGTCTTTTTGGG - Intergenic
1158514552 18:58120168-58120190 GGATTTCTGCCTTTCTATTTGGG - Intronic
1158866534 18:61643213-61643235 GGACTTCAACATATCTTTTTTGG - Intergenic
1159146575 18:64462235-64462257 GGACTTCAACATTTCTTTTTGGG - Intergenic
1162006349 19:7782491-7782513 GGCATTCAGCATGTCTTTTTGGG + Intergenic
1164526728 19:29018528-29018550 GGACTTCAGCATGTCTTTCTGGG - Intergenic
1164779726 19:30882707-30882729 GGAGTACAGCTTTTGTATTTTGG - Intergenic
1165583474 19:36890966-36890988 GGACTTCAGCATATCTTTTTAGG - Exonic
1166616714 19:44255256-44255278 GGACTTCAACATATCTTTTTGGG + Intronic
1166877267 19:45905010-45905032 GGACTTCAGCCTCTCTTTTTGGG - Intergenic
1166971728 19:46573276-46573298 GGGCTTCAGCATATCTTTTTGGG - Intronic
1167087230 19:47318799-47318821 GGACTGCAGCCTTTCTTTCTTGG + Intronic
1167098817 19:47391434-47391456 GAGGTTCAGAGTTTCTTTTGGGG + Intergenic
1168430720 19:56277565-56277587 GGGGTTCAGGGTTTATTTTGGGG + Intronic
1168496840 19:56859983-56860005 GGAGTGAAGAGTTTTTTTTTAGG + Intergenic
1202684138 1_KI270712v1_random:33339-33361 GGAGCTTAGAGTTTCATTTTTGG - Intergenic
924959922 2:25451-25473 GAAATACAGCGTTTCTTTCTGGG - Intergenic
925623709 2:5820571-5820593 GGGGTACTGCGTTTCTTCTTGGG - Intergenic
926091502 2:10053362-10053384 GGATTTGAGTGTTTCTTTTTTGG - Exonic
926210702 2:10867540-10867562 GGACTTCAGCGTATGATTTTTGG + Intergenic
927052894 2:19347947-19347969 GGAGTTCAGTGTTTTGCTTTTGG - Intergenic
927418968 2:22909516-22909538 AGAATTCAGTTTTTCTTTTTTGG - Intergenic
927756402 2:25711703-25711725 GGACTTCAGCTTTTCTTTGTGGG - Intergenic
927756506 2:25712795-25712817 GGACTTCAACGTATCTTTTGTGG - Intergenic
927984771 2:27401464-27401486 AGAGTACAGGGTTTCTTTTTGGG + Intronic
928223597 2:29426304-29426326 GGAATTCAACATGTCTTTTTGGG + Intronic
928413127 2:31069702-31069724 CGAGTTCAGCTTTTACTTTTGGG - Intronic
928500502 2:31888779-31888801 GAAATGCAGGGTTTCTTTTTGGG + Intronic
928902687 2:36337581-36337603 GGAGTTCAGCTTTGCATGTTTGG - Intergenic
929796773 2:45065624-45065646 AGACTTCAACATTTCTTTTTGGG - Intergenic
929829935 2:45339103-45339125 GAAGCTCAGGATTTCTTTTTTGG + Intergenic
929869887 2:45750243-45750265 TGAGTACAGGGTTTCCTTTTGGG - Intronic
929931554 2:46260476-46260498 TGGGTACAGGGTTTCTTTTTGGG - Intergenic
930424637 2:51197124-51197146 GAACTTCAACATTTCTTTTTGGG - Intergenic
930815833 2:55597083-55597105 TGGGTTCAGAGTTTCTGTTTGGG + Intronic
930947009 2:57086451-57086473 CGATTTCAAAGTTTCTTTTTTGG - Intergenic
931460839 2:62448785-62448807 GGAGTCCAGGCTTTCTCTTTTGG - Intergenic
931663132 2:64588071-64588093 TGGGTACAGGGTTTCTTTTTGGG - Intronic
932103318 2:68920781-68920803 GTAGTTCAGCCTGTCTCTTTTGG + Intergenic
932260964 2:70327089-70327111 GGACTTCAACATATCTTTTTAGG - Intergenic
932903740 2:75727967-75727989 TGGGTACAGGGTTTCTTTTTGGG + Intergenic
934067462 2:88353158-88353180 GGACTTCAACATATCTTTTTGGG - Intergenic
934247583 2:90321513-90321535 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
934261741 2:91481088-91481110 GGAGCTTAGAGTTTCATTTTTGG - Intergenic
934304782 2:91812067-91812089 GGAGCTTAGAGTTTCATTTTTGG - Intergenic
934328475 2:92040683-92040705 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
934466852 2:94271189-94271211 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
935233116 2:101116532-101116554 GGATTTCAATGTATCTTTTTTGG - Intronic
937323598 2:120975548-120975570 GGAGTTGATCCTTTCCTTTTGGG + Intronic
938274538 2:130006217-130006239 GGAGTTCAGCGATTCCTACTTGG + Intergenic
938440829 2:131331055-131331077 GGAGTTCAGCGATTCCTACTTGG - Intronic
938586216 2:132693209-132693231 GAACTTCAACGTATCTTTTTAGG - Intronic
938971275 2:136435205-136435227 GGAGTGCAGTGGTTCGTTTTCGG + Intergenic
939059754 2:137406787-137406809 GAAGTACAGCATTTCTTGTTTGG - Intronic
940158941 2:150691262-150691284 GGGATTTAGCATTTCTTTTTTGG - Intergenic
940736216 2:157455781-157455803 GGATGTCAACGTATCTTTTTAGG - Intronic
941503014 2:166304791-166304813 TGAGTACAGAGTTTCTATTTGGG + Intronic
942148695 2:173053093-173053115 TGAGTTCAGAGTTTCTTTTAGGG - Intergenic
942159365 2:173166045-173166067 TGGGTACAGCGTTTCTGTTTGGG - Intronic
942162769 2:173209397-173209419 GGACTTCACTGTTTCCTTTTAGG + Intronic
942712923 2:178858506-178858528 TGAGTGCAGAGTTTCTGTTTAGG + Intronic
943340214 2:186671739-186671761 TGGGTACAGCATTTCTTTTTGGG - Intronic
943483099 2:188446527-188446549 TGAGTTCAACTTTGCTTTTTGGG + Intronic
943915847 2:193631187-193631209 TGAGTCCAGTGTTTCTTTATTGG - Intergenic
944438101 2:199712957-199712979 GGACTTCAAAGTATCTTTTTTGG + Intergenic
944631335 2:201628498-201628520 GGAGTTCAACATATCTTTTTGGG - Intronic
944979659 2:205101896-205101918 GGAGTTTGAGGTTTCTTTTTGGG + Intronic
945746462 2:213724724-213724746 GGAGTGCAGTGGTGCTTTTTCGG - Intronic
946229709 2:218283636-218283658 AGAGACCAGCGTCTCTTTTTAGG + Intronic
946465676 2:219909880-219909902 GGACTTCAGCATATCTTCTTGGG + Intergenic
946654353 2:221929750-221929772 GAAGTACAGGGTTTCTTTTTAGG + Intergenic
946757308 2:222960688-222960710 TGAATACAGGGTTTCTTTTTGGG - Intergenic
947205342 2:227655868-227655890 GGACTTCAACGTGTCTTTCTGGG - Intergenic
947873744 2:233454495-233454517 GGAGTACAGGCTTTCTCTTTAGG + Intronic
948153888 2:235765476-235765498 AGTGTTCAGCTTCTCTTTTTAGG - Intronic
948333040 2:237185184-237185206 GGTGTTCAGCCTTCCTTCTTAGG + Intergenic
948782083 2:240328042-240328064 GGACTTCAACATATCTTTTTGGG + Intergenic
1168908295 20:1424436-1424458 TGGGTACAGGGTTTCTTTTTGGG - Intergenic
1169274433 20:4224144-4224166 GAAGTTCAGCTTTTATTTTGTGG + Intronic
1169395448 20:5224975-5224997 GGACTTCAACTTATCTTTTTGGG - Intergenic
1169408673 20:5348445-5348467 GGACTTCAGCATATCTTTTAGGG - Intergenic
1170195958 20:13689682-13689704 GTAGTTCTAGGTTTCTTTTTGGG - Intergenic
1170225324 20:13985769-13985791 GGGGTACAGGATTTCTTTTTGGG - Intronic
1170250904 20:14281443-14281465 TGGGTATAGCGTTTCTTTTTGGG + Intronic
1170951277 20:20938449-20938471 GGACTTCAGCGTATCTTTTGTGG + Intergenic
1171634181 20:27249511-27249533 GGAGTTGAACCTTTCTTTTGAGG + Intergenic
1171736083 20:28787026-28787048 AGAATTCAACCTTTCTTTTTTGG - Intergenic
1172294751 20:33800992-33801014 TGGGTACAGGGTTTCTTTTTGGG - Intergenic
1172970081 20:38866881-38866903 TGAGTCCAGGGTTTCCTTTTGGG - Intronic
1173418448 20:42879552-42879574 GGACTTCAACTTATCTTTTTAGG + Intronic
1173459657 20:43232973-43232995 GGACTTCAACGTATCTTTTAGGG - Intergenic
1173532009 20:43776996-43777018 GGACTTCAACCTATCTTTTTTGG + Intergenic
1173964688 20:47103221-47103243 TGAGTATAGGGTTTCTTTTTGGG - Intronic
1174279570 20:49429281-49429303 TGGGTACAGGGTTTCTTTTTGGG + Intronic
1174839449 20:53887788-53887810 GGAGTACAGAGTTTCTGTTTGGG - Intergenic
1175711661 20:61226349-61226371 TGGGTTCAGGGTTTCCTTTTGGG - Intergenic
1176587088 21:8597446-8597468 GGAGCTTAGAGTTTCATTTTTGG - Intergenic
1176910721 21:14561614-14561636 GGAATTCAACATATCTTTTTTGG - Intronic
1178027257 21:28482494-28482516 GGATTTCAACATATCTTTTTGGG - Intergenic
1178041125 21:28642231-28642253 GGATTTCAGCTTTTCAATTTTGG - Intergenic
1178308130 21:31507861-31507883 GGACTTCAGCATATCTTTTAAGG - Intronic
1178308493 21:31510054-31510076 GGACTTCAGCATATCTTTTTGGG - Intronic
1178635244 21:34296742-34296764 GAACTTCAGCATATCTTTTTTGG + Intergenic
1178738294 21:35172211-35172233 GGACTTCAATGTATCTTTTTTGG - Intronic
1178935246 21:36856096-36856118 TGGGTACAGGGTTTCTTTTTGGG + Intronic
1178980988 21:37265157-37265179 TGGGTTCAGGGTTTCTTTTTGGG + Intronic
1179257628 21:39730428-39730450 GGACTTCAACATGTCTTTTTTGG + Intergenic
1180269917 22:10574443-10574465 GGAGCTTAGAGTTTCATTTTTGG - Intergenic
1180587990 22:16910420-16910442 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
1180695047 22:17746569-17746591 GGACTTGCGCTTTTCTTTTTGGG - Intronic
1181600167 22:23946950-23946972 TGGGTACAGAGTTTCTTTTTTGG + Intergenic
1181608338 22:23994373-23994395 TGGGTACAGAGTTTCTTTTTGGG - Intergenic
1181613268 22:24033873-24033895 GGGGTTTAGGGTTTCTTTCTGGG - Intronic
1181994715 22:26867743-26867765 GTATTTTAGCTTTTCTTTTTGGG + Intergenic
1182606064 22:31504984-31505006 GGATTTCAGCAAATCTTTTTTGG + Intronic
1183158295 22:36092620-36092642 TGGGTACAGAGTTTCTTTTTGGG - Intergenic
1184293736 22:43511228-43511250 GGGGTTCAGCTTTTCTTCTGGGG - Intergenic
949220525 3:1628134-1628156 GGAGAAAAACGTTTCTTTTTGGG + Intergenic
950129092 3:10529676-10529698 GGACTTCAACCTATCTTTTTGGG - Intronic
950292363 3:11795615-11795637 GGAGTTCAGGGTTTCTTTTGAGG - Intronic
950810873 3:15648671-15648693 GGACTACAACGTATCTTTTTTGG - Intergenic
951054465 3:18131822-18131844 GGAGTTCAGCCTTTATTGGTGGG - Intronic
951528861 3:23680288-23680310 GGAGTTGAACATATCTTTTTTGG - Intergenic
951621103 3:24603007-24603029 GGACTTGAGCATGTCTTTTTGGG - Intergenic
952886478 3:38015456-38015478 GGGGTACAGTGTTTCTTTCTGGG + Intronic
953554193 3:43929897-43929919 TGGGTACAGGGTTTCTTTTTGGG + Intergenic
954423874 3:50433125-50433147 TGGGTACAGGGTTTCTTTTTCGG - Intronic
954436843 3:50500763-50500785 GGGCTTCAGGGTTTTTTTTTGGG - Intronic
954615049 3:51965214-51965236 GGAGTTCAGGCTTTATTCTTTGG - Intronic
955182941 3:56688836-56688858 TGAGTACAGGGTTTCTTTTTGGG + Intergenic
955998733 3:64705935-64705957 TGTGTGCAGGGTTTCTTTTTGGG - Intergenic
956219882 3:66891209-66891231 GGAATTTAGGGTTTCTTTTTGGG - Intergenic
956390656 3:68769726-68769748 GGATTTCTGCATTTGTTTTTGGG - Intronic
956527873 3:70185062-70185084 GGGGCTCAGTGTTTCTATTTGGG - Intergenic
956663689 3:71622742-71622764 GGACTCCAACGTATCTTTTTGGG - Intergenic
956706803 3:72006063-72006085 GGACTTCAACATATCTTTTTAGG - Intergenic
956756323 3:72391235-72391257 GGAATTCACCTTTTCTCTTTAGG - Intronic
956864383 3:73355265-73355287 GGACTTCAACATATCTTTTTTGG - Intergenic
957423179 3:79999579-79999601 GGACTGCAACATTTCTTTTTAGG + Intergenic
957828469 3:85483235-85483257 GGAATACAGAGTTTCTATTTTGG - Intronic
957935263 3:86934321-86934343 GGAGTTCTGAGTTTCCTGTTTGG + Intergenic
958003277 3:87778585-87778607 TGAGTTCTGCTTTTCTTTATGGG - Intergenic
958024690 3:88037254-88037276 GGATTTCAAAGTATCTTTTTGGG - Intergenic
958203901 3:90362978-90363000 AGAGTTGAACGTTTCTTTTGGGG - Intergenic
958212564 3:90507190-90507212 GGAGTTTAACCTTTCTTTTGAGG - Intergenic
958743586 3:98106004-98106026 AAAGTTGAGTGTTTCTTTTTTGG + Intergenic
960228893 3:115201245-115201267 GAAGTTCAGAGTTGCTTTTGTGG - Intergenic
960658549 3:120032973-120032995 GAGGTACAGTGTTTCTTTTTGGG - Intronic
960658717 3:120034713-120034735 GGAGTTTAACATATCTTTTTTGG - Intronic
960929546 3:122831625-122831647 TGGGTACAGAGTTTCTTTTTGGG + Intronic
960991165 3:123312513-123312535 TGGGTTCAGAGTTTCTGTTTGGG - Intronic
961320826 3:126073734-126073756 GGTGTTAAGCTTTTCTTTGTGGG - Intronic
961526695 3:127506116-127506138 GGACTTAAGCTTTTCTTTATGGG - Intergenic
962643373 3:137411740-137411762 AGACTTCAGCATATCTTTTTGGG + Intergenic
962718964 3:138154498-138154520 TGAATACAGGGTTTCTTTTTGGG - Intergenic
964044074 3:152300099-152300121 TCAGTTCAGCTTTTTTTTTTTGG + Exonic
964224892 3:154386923-154386945 TAAATTCAGCTTTTCTTTTTTGG + Intronic
966707491 3:182932340-182932362 TGGGTACAGAGTTTCTTTTTGGG + Intergenic
967048525 3:185760508-185760530 TGGGTACAGAGTTTCTTTTTGGG - Intronic
967180755 3:186901653-186901675 GGACTTCAACATGTCTTTTTTGG + Intergenic
967945282 3:194799130-194799152 GGAGTTCGGGGCTTCTGTTTTGG + Intergenic
968182606 3:196607674-196607696 TTAGTTCTGCTTTTCTTTTTGGG - Intergenic
968718841 4:2183688-2183710 GGAGTACAGGGTTTTTTTTTGGG + Intronic
970106041 4:12585555-12585577 TGAGTACAGCATTTCTTTCTGGG + Intergenic
970138379 4:12951454-12951476 GGACTTCAGCATATCTTTTGGGG + Intergenic
970845011 4:20527284-20527306 AGAGTTCATCTTTTTTTTTTTGG + Intronic
971927743 4:33035460-33035482 GGTGCTCAGATTTTCTTTTTTGG - Intergenic
972502216 4:39688937-39688959 TGGGTACAGGGTTTCTTTTTGGG - Intergenic
973317064 4:48772789-48772811 GCAGTGCAGCCTTGCTTTTTAGG - Intronic
973791389 4:54381144-54381166 GGACTTCCACGTATCTTTTTTGG + Intergenic
974005508 4:56552586-56552608 GGAGTTCCCCATTGCTTTTTAGG - Exonic
974869551 4:67622940-67622962 GGCTTTCATTGTTTCTTTTTTGG - Intronic
974956511 4:68647788-68647810 TCAGTTCAGCCTTTCTCTTTCGG + Intronic
975487544 4:74950572-74950594 GTGGTTCAGCTTATCTTTTTGGG + Intronic
975598753 4:76077144-76077166 TAAGTACAGGGTTTCTTTTTGGG - Intronic
975996139 4:80318071-80318093 GGAGTACAGGGTTTCTTTGGGGG + Intronic
976003978 4:80406299-80406321 GAAGTTCTGCATTTCTTTGTGGG + Intronic
976163020 4:82223747-82223769 GGACTTCAACATATCTTTTTGGG - Intergenic
976596724 4:86901841-86901863 GGACTTCAACATATCTTTTTAGG - Intronic
976702832 4:87989840-87989862 GGACTTTAACATTTCTTTTTGGG - Intergenic
976705186 4:88012683-88012705 TGAGTACAGAGTTTCTGTTTGGG - Intronic
976962224 4:90991727-90991749 GGACTTCAACATATCTTTTTAGG + Intronic
977584998 4:98765005-98765027 TGAGTACAGGATTTCTTTTTGGG - Intergenic
977910271 4:102526218-102526240 GGAGTTAAAGGTGTCTTTTTGGG + Intronic
977922606 4:102662058-102662080 GGAGATATGCCTTTCTTTTTAGG - Intronic
980148557 4:129019780-129019802 ACAGTGCAGCATTTCTTTTTGGG + Intronic
982276154 4:153639043-153639065 GGAGTGCAGTGTTGCTGTTTCGG - Intergenic
982702841 4:158675176-158675198 GGAGTGAATAGTTTCTTTTTGGG - Intronic
983136836 4:164094415-164094437 GGAGATTAGCGTCTCTTTTTGGG - Intronic
984982078 4:185291887-185291909 GGACTTCAACATATCTTTTTGGG + Intronic
985490233 5:174707-174729 TGCAGTCAGCGTTTCTTTTTTGG + Intronic
985721223 5:1490261-1490283 GGACTTCAGCTTGTCTTTTAGGG - Intronic
986239632 5:5948161-5948183 GCAATTCAGAGTTTGTTTTTAGG + Intergenic
986249032 5:6039110-6039132 GTGGTTCTGTGTTTCTTTTTTGG + Intergenic
986584226 5:9298062-9298084 GGACTTCACCGTATCTTTTGGGG - Intronic
986745218 5:10737770-10737792 GGATTTCAGCATGCCTTTTTTGG - Intronic
987762461 5:22183293-22183315 GGTGATCAGAATTTCTTTTTAGG + Intronic
987782623 5:22458435-22458457 GGATTTCAACATTTCTTTTTTGG + Intronic
988462047 5:31448373-31448395 TGAGTACAGGGTTTCTCTTTGGG + Intronic
988771735 5:34439499-34439521 GTAGTCCAGCCTTTCTCTTTGGG - Intergenic
989001208 5:36762674-36762696 GGACTTCAACATATCTTTTTTGG + Intergenic
989005139 5:36801680-36801702 TGAGTACAGAGTTTCTGTTTGGG + Intergenic
989048269 5:37294868-37294890 TGAGCACAGAGTTTCTTTTTGGG + Intronic
990392875 5:55345472-55345494 TGTGTACAGGGTTTCTTTTTGGG - Intronic
991129689 5:63107763-63107785 GGGCTTCAACATTTCTTTTTAGG + Intergenic
991270510 5:64773481-64773503 TGAGTACAGGGTTTCTTTTTAGG + Intronic
991443328 5:66674584-66674606 TGAGTTCAGAGTCTCTCTTTTGG + Intronic
991668313 5:69022143-69022165 GGACTTCAACATATCTTTTTGGG - Intergenic
991974013 5:72168252-72168274 GGTGTTCAGTGTTGCTTTCTGGG + Intronic
992052473 5:72954329-72954351 GGAGTTCACCGTTTGTTTTGAGG + Intergenic
992272912 5:75084035-75084057 TGGGTACAGGGTTTCTTTTTGGG + Intronic
992577812 5:78137048-78137070 TGAGTACAGAGTTTCTATTTGGG - Intronic
992821575 5:80502996-80503018 TGAGTACAGGGTTTCTTTTTTGG + Intronic
992846269 5:80751783-80751805 GGACTTCAGCATATCTTTTTAGG + Intronic
993319273 5:86452812-86452834 GAAGTCCAGACTTTCTTTTTTGG + Intergenic
994868465 5:105311981-105312003 TGAGTATAGAGTTTCTTTTTGGG - Intergenic
995212918 5:109560930-109560952 GGACTTCAACATATCTTTTTGGG + Intergenic
995285154 5:110379851-110379873 TGAGTTCAGAGTTTCTTTGAGGG - Intronic
996464367 5:123782551-123782573 GGAGTTCAGAATTTATTCTTAGG + Intergenic
996856023 5:128008172-128008194 TGAGTACAGAGTTTCTGTTTCGG + Intergenic
997133108 5:131296719-131296741 GGATTTCAACATATCTTTTTGGG + Intronic
997180679 5:131825527-131825549 TGAGGTCAGGGTTTCTATTTGGG + Intronic
997853065 5:137349920-137349942 GGACTTCAACATCTCTTTTTGGG + Intronic
997895689 5:137714668-137714690 AGAATACAGCGTTTCTATTTAGG + Intronic
998100679 5:139431327-139431349 GGAGTATAGAGTTTCTTTTTGGG - Intronic
998105780 5:139468350-139468372 GGAGTGTGGGGTTTCTTTTTAGG - Intergenic
998938283 5:147254226-147254248 GGACTTCAACCTATCTTTTTGGG + Intronic
999362210 5:150995340-150995362 ATAGTTCAGTATTTCTTTTTAGG - Intergenic
999704961 5:154263877-154263899 TGGGTACAGAGTTTCTTTTTAGG + Intronic
1000229685 5:159303766-159303788 GGGGTGCTGTGTTTCTTTTTGGG + Intergenic
1000244018 5:159434046-159434068 GGACTTCAACCTATCTTTTTGGG - Intergenic
1001085611 5:168698226-168698248 GGACTTCAACATATCTTTTTTGG - Intronic
1001922786 5:175613607-175613629 GGGGTACAGGGTTTCTTTTTGGG - Intergenic
1002379298 5:178814161-178814183 CAAGATCAGCGTTTCTTTGTGGG + Intergenic
1002958261 6:1889733-1889755 TGGGTACAGTGTTTCTTTTTGGG - Intronic
1003098768 6:3161329-3161351 GGAGTTCAGACTTTTATTTTAGG - Intergenic
1003610917 6:7614432-7614454 TGGGTTCAGAGTTTCCTTTTGGG - Intergenic
1003983659 6:11413920-11413942 GAAGCTCAGGGTTTCTTTTTGGG + Intergenic
1003990412 6:11481376-11481398 GGAGTTCAACATATCTTTTTTGG - Intergenic
1004085244 6:12441339-12441361 GGACTTCACAGTATCTTTTTGGG - Intergenic
1004325903 6:14673867-14673889 GGGGTACAGGGTTTCTTTTGGGG - Intergenic
1004491812 6:16124926-16124948 GGTGTTCAGAGTCTCTTATTTGG + Intergenic
1005036075 6:21555985-21556007 GGACTTCAGCATATCTTTTTCGG - Intergenic
1005583815 6:27257206-27257228 GGAGTTCAATATATCTTTTTTGG + Intergenic
1006017669 6:31095112-31095134 AGATTTCAGCGTATCTTTTGGGG + Intergenic
1007833756 6:44658375-44658397 GGAGTACAAGGTTTCCTTTTGGG - Intergenic
1008141479 6:47837232-47837254 GAAGTTCAGGGTTTATTTTAGGG + Intergenic
1008415335 6:51233329-51233351 GGACTTCAACATATCTTTTTGGG + Intergenic
1008893300 6:56521535-56521557 GGATTTCAGCTTTCCTTTTTTGG - Intronic
1009591250 6:65673528-65673550 GGGGTTCAGCGTAAGTTTTTGGG + Intronic
1010152197 6:72746133-72746155 GGACTTCAACATTTCTTTATAGG + Intronic
1010291667 6:74144844-74144866 GGTGTTCAGGGTTTATTTTGGGG - Intergenic
1010438612 6:75865412-75865434 GGAGTGCAGTGGTTCTTTCTTGG + Intronic
1010869770 6:81022570-81022592 GGAGCTAAGCGTTTCCTTTGTGG + Intergenic
1011867635 6:91850848-91850870 GGAGTTCAGGGTTTCTGTTCTGG - Intergenic
1013085580 6:106854360-106854382 GGATTTCAGTATATCTTTTTTGG - Intergenic
1013290110 6:108712481-108712503 GGAGTTCAGGGATTCTTGATAGG + Intergenic
1013544964 6:111147074-111147096 TGGGTACAGGGTTTCTTTTTGGG + Intronic
1014792129 6:125684625-125684647 TGAGTTAATGGTTTCTTTTTTGG - Intergenic
1015027543 6:128555149-128555171 GGACTTCAGCATATCTTTTTTGG - Intergenic
1015220459 6:130798921-130798943 TGTTTTCATCGTTTCTTTTTTGG + Intergenic
1016134516 6:140523129-140523151 GGACTTCAACATATCTTTTTTGG + Intergenic
1016327098 6:142915195-142915217 GAACTTCAATGTTTCTTTTTGGG - Intronic
1016551303 6:145283268-145283290 GGACTTCAGCATATCTTTTTGGG - Intergenic
1016942012 6:149490347-149490369 GGACTTGAACGTATCTTTTTGGG - Intergenic
1017374909 6:153758267-153758289 GAATTTCAGGGTTTTTTTTTTGG - Intergenic
1017448373 6:154529924-154529946 GGACTTCAACGTATCTTTTGGGG - Intergenic
1018035441 6:159877484-159877506 GGACTTCAGCGTATCTTTTTAGG - Intergenic
1021131615 7:16919296-16919318 CGGGTGCAGGGTTTCTTTTTGGG - Intergenic
1021492879 7:21238857-21238879 TGAGTACAGAGTTTCTATTTGGG + Intergenic
1022723341 7:32959572-32959594 TGGGTCCAGCGTTTCTTTTTTGG - Intronic
1022777387 7:33541822-33541844 TGAGTACAGAGTTTCCTTTTGGG + Intronic
1023124037 7:36937130-36937152 GGACTTCAGCATATCTTTTGGGG - Intronic
1023482439 7:40648484-40648506 GGACTTCAACGTATCTTTTGGGG - Intronic
1023790957 7:43753334-43753356 GGACTTCAATGTATCTTTTTTGG + Intergenic
1024039550 7:45541336-45541358 TGGGTACAGAGTTTCTTTTTGGG + Intergenic
1026172100 7:67962989-67963011 GGAGTTCAGCTTTGGTCTTTTGG + Intergenic
1026433368 7:70370283-70370305 GGAGTGCAGGGTTTCTTTTTTGG - Intronic
1026859514 7:73776516-73776538 TGGGTACAGGGTTTCTTTTTGGG + Intergenic
1027240932 7:76328321-76328343 GGAGTTCAGTGTTTGTTATCTGG + Exonic
1028795661 7:94899845-94899867 TGAGTACAGAGTTTCTTTTAAGG - Intergenic
1028829040 7:95306646-95306668 GCATTACAGCGTTTCTCTTTTGG + Intronic
1029069661 7:97884844-97884866 TGGATACAGCGTTTCTTTTTGGG - Intergenic
1030327839 7:108240024-108240046 GCAGATAAGCGCTTCTTTTTCGG + Exonic
1031091161 7:117356496-117356518 GGAGTAAGGGGTTTCTTTTTGGG + Intergenic
1032365198 7:131292417-131292439 GGACTTCAACATATCTTTTTGGG - Intronic
1032463065 7:132126107-132126129 GAAATTGAGCTTTTCTTTTTAGG + Exonic
1032728885 7:134618028-134618050 GGATTTGAGCATATCTTTTTGGG - Intergenic
1032860235 7:135871063-135871085 GGACTTCAACGTATCTTTTGGGG - Intergenic
1033094106 7:138414651-138414673 GGACTTCAATGTATCTTTTTTGG + Intergenic
1033250859 7:139757722-139757744 TGGGTACAGAGTTTCTTTTTGGG + Intronic
1033439475 7:141365893-141365915 GGACTTCAGTGTATCTTTTTTGG + Intronic
1033828111 7:145217542-145217564 GAAGTTCAGCGTTATTTATTGGG + Intergenic
1034508409 7:151515365-151515387 TGAGTACAGAGTTTCTTTTTGGG + Intronic
1034991646 7:155551290-155551312 GGATGTCAGCTTATCTTTTTGGG - Intergenic
1035253359 7:157611529-157611551 GGACTCCAGTGTGTCTTTTTGGG - Intronic
1035286302 7:157809491-157809513 GGAGTTGAACGTGTCTTTTTGGG - Intronic
1035546932 8:488946-488968 GCAGTTAAGCATTTTTTTTTTGG + Intergenic
1036515537 8:9440164-9440186 GGACTTCAACCTATCTTTTTGGG + Intergenic
1037072994 8:14675580-14675602 GGAGCTCAGTGTATATTTTTTGG - Intronic
1037313627 8:17581098-17581120 GGACTTCAGCATATCTTTTTAGG + Intronic
1038332526 8:26620105-26620127 TGGGTACAGCCTTTCTTTTTTGG + Intronic
1039076155 8:33692312-33692334 TGGGTACAGAGTTTCTTTTTGGG - Intergenic
1040882024 8:52216074-52216096 GGAGTTCATCCTTGCCTTTTGGG - Intronic
1041252713 8:55949887-55949909 GGGGTGCAGGGTTTCCTTTTGGG - Intronic
1041684314 8:60628814-60628836 GGATTTCAACCTATCTTTTTAGG - Intergenic
1042206788 8:66337647-66337669 GGACTCCAGCATATCTTTTTGGG + Intergenic
1042238821 8:66641576-66641598 AAGGTTCAGGGTTTCTTTTTGGG - Intronic
1042576883 8:70230345-70230367 TGAGTACAGGGTTTCTTTTGGGG + Intronic
1043407949 8:79958127-79958149 TGAGTACAGGGTTTCTTTTTTGG - Intronic
1044412591 8:91901309-91901331 GGGATACAGCATTTCTTTTTAGG + Intergenic
1044438039 8:92189033-92189055 GGACTTCAGTGTATCTTTTCGGG + Intergenic
1045071436 8:98508504-98508526 TGGGTACAGGGTTTCTTTTTGGG + Intronic
1045824426 8:106380055-106380077 CGGGTTCAGTATTTCTTTTTAGG - Intronic
1046951546 8:120024406-120024428 GGACTTCAACATATCTTTTTGGG - Intronic
1047329260 8:123871429-123871451 GGTGTTTAGCGCTTCCTTTTTGG - Intronic
1048564431 8:135580370-135580392 GGAGTTGATGCTTTCTTTTTTGG + Intronic
1049675786 8:143888354-143888376 GGACTTCGGCATGTCTTTTTGGG - Intergenic
1050590177 9:7152572-7152594 TGAGTGCAGAGTTTCTGTTTGGG + Intergenic
1050805632 9:9673542-9673564 AGTGTTCATCTTTTCTTTTTGGG - Intronic
1051175769 9:14358019-14358041 GTGGTGCAGAGTTTCTTTTTAGG + Intronic
1051434181 9:17013288-17013310 GGAATTCAGCATTTCTTTGGGGG + Intergenic
1051476748 9:17517052-17517074 GGACTTCAGCATATCTTTTGGGG - Intergenic
1051625385 9:19094352-19094374 GGAATTCAGTGTCACTTTTTTGG + Exonic
1051643259 9:19243479-19243501 CGGGTACAGCGTTTCCTTTTAGG - Intronic
1052512986 9:29445605-29445627 AGAGGGCAGGGTTTCTTTTTGGG + Intergenic
1053068467 9:35085820-35085842 AGGGTACAGGGTTTCTTTTTGGG + Intergenic
1053181347 9:35973215-35973237 GGACTTGAGCTTTTCTTTGTTGG + Intergenic
1053696903 9:40647998-40648020 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
1053943299 9:43278132-43278154 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
1054308155 9:63447231-63447253 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
1054406889 9:64771222-64771244 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
1054440513 9:65256688-65256710 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
1054489894 9:65765236-65765258 GGAGCTTAGAGTTTCATTTTTGG - Intergenic
1055088686 9:72340286-72340308 GGACTCCAGCATATCTTTTTGGG - Intergenic
1056370996 9:85954129-85954151 GGAGTTCAGTGGTTCTGTTGTGG + Intronic
1057281106 9:93712256-93712278 GGAGTTCAGTGGTACTATTTTGG - Intergenic
1057492006 9:95527719-95527741 GGACTTCAACATTTCTTTTTTGG + Intergenic
1057552176 9:96059561-96059583 AGGGTACAGCATTTCTTTTTAGG + Intergenic
1057987739 9:99734279-99734301 TGGGTTCAGAGTTTCTGTTTGGG + Intergenic
1058083186 9:100720819-100720841 GGAGTACAGAGTTTCTGTTTGGG + Intergenic
1058116438 9:101090273-101090295 TGACTTCAGTGTATCTTTTTGGG + Intronic
1058217457 9:102253098-102253120 TGTGTGCAGAGTTTCTTTTTGGG - Intergenic
1059065088 9:111075307-111075329 GGAGTGCAGTGTTTCTATCTTGG - Intergenic
1059109909 9:111546801-111546823 GGAGTACAGAGTTTCAGTTTGGG - Intronic
1059526782 9:114999366-114999388 GGAGTGAGGGGTTTCTTTTTGGG + Intergenic
1059667266 9:116460275-116460297 GGGTTACAGAGTTTCTTTTTCGG + Intronic
1060001787 9:119965400-119965422 GGACTTCAACATATCTTTTTTGG - Intergenic
1060139014 9:121188924-121188946 TGAGTTCAGAGTTTCTCTCTGGG - Intronic
1061389321 9:130308609-130308631 AGAGTTGAGCGTTTTTTTTAGGG + Intronic
1202779356 9_KI270717v1_random:21657-21679 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
1203586419 Un_KI270747v1:8037-8059 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
1185520047 X:731881-731903 GGGGTTCAGGGTTGCCTTTTGGG - Intergenic
1185780437 X:2839644-2839666 TGAGTGCAGGGTCTCTTTTTGGG + Intronic
1186435009 X:9535178-9535200 GGATTTCAGAGCTTCTTTTTAGG - Intronic
1186461473 X:9751637-9751659 TGGGTACAGGGTTTCTTTTTGGG + Intronic
1186674118 X:11797867-11797889 TGGGTACAGAGTTTCTTTTTGGG + Intergenic
1186694807 X:12018848-12018870 GGACTTCAACATATCTTTTTGGG + Intergenic
1186770440 X:12812762-12812784 TGGGTACAGGGTTTCTTTTTGGG - Intronic
1187091011 X:16096485-16096507 GGAGTCCAGCATTTTTTGTTTGG + Intergenic
1187553715 X:20331385-20331407 GTGGTACAGGGTTTCTTTTTAGG - Intergenic
1187909496 X:24097863-24097885 TGAGTCTAGGGTTTCTTTTTGGG - Intergenic
1188016736 X:25114650-25114672 CGACTTCAACGTATCTTTTTGGG - Intergenic
1189108745 X:38264950-38264972 GGACTTCAACATATCTTTTTGGG - Intronic
1189151742 X:38715768-38715790 AGGGTACAGGGTTTCTTTTTAGG + Intergenic
1190382920 X:49856839-49856861 GGAGTTCAACATATCTTTCTGGG - Intergenic
1190439688 X:50464893-50464915 AGAGTACAGGGTTTCTTTTGAGG - Intronic
1192601663 X:72470971-72470993 TGGGTTCAGGGTTTCTTTTGAGG - Intronic
1193180007 X:78443243-78443265 TGGGTACAGAGTTTCTTTTTGGG - Intergenic
1195052353 X:101108577-101108599 TGAGTACAGGGTTTCTTCTTGGG - Intronic
1196059676 X:111394364-111394386 AGGGTACAGCGTTTCTTTTTGGG + Intronic
1196109455 X:111930548-111930570 GGAGTTCAGCGGTGCAATTTCGG - Intronic
1196317129 X:114240950-114240972 AGGGTACAGTGTTTCTTTTTTGG - Intergenic
1197095908 X:122594884-122594906 AGAGTTCAACTTTACTTTTTGGG + Intergenic
1197683415 X:129411390-129411412 GGATTTCAACATATCTTTTTGGG - Intergenic
1198076758 X:133200999-133201021 TGGGTGCAGAGTTTCTTTTTGGG - Intergenic
1198368083 X:135963168-135963190 AGGGTACAGGGTTTCTTTTTGGG + Exonic
1198410771 X:136365246-136365268 TGGGTACAGGGTTTCTTTTTGGG - Intronic
1198678231 X:139153659-139153681 GGATTTAAACGTATCTTTTTGGG - Intronic
1199886202 X:152024321-152024343 GGAGCTCAGCTTTGCTTGTTGGG - Intergenic
1200128145 X:153827724-153827746 GGAGTGCAGGGTTTCTTTTGGGG + Intronic
1200141466 X:153904853-153904875 GGAGTTCTGCGTGTCTGTCTGGG + Intronic
1200170165 X:154066973-154066995 GGACTTCAACATATCTTTTTTGG - Intronic
1200289008 X:154854037-154854059 TGAGTACAGAGTTTCTGTTTGGG - Intronic
1200373444 X:155753215-155753237 TGGGTACAGGGTTTCTTTTTGGG - Intergenic
1200927167 Y:8665008-8665030 GGATTTCAAGGTTTATTTTTGGG - Intergenic
1201051264 Y:9938064-9938086 GGAGTTCTACTTTTCTTCTTGGG - Intergenic
1201194628 Y:11479938-11479960 GGAGCTTAGAGTTTCATTTTTGG + Intergenic
1201289620 Y:12410333-12410355 TGAGTGCAGGGTCTCTTTTTGGG - Intergenic
1202097683 Y:21268997-21269019 CAAGTTCAGGCTTTCTTTTTGGG - Intergenic