ID: 1153240508

View in Genome Browser
Species Human (GRCh38)
Location 18:3027326-3027348
Sequence TTTTAGAAGCTATAGAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153240503_1153240508 19 Left 1153240503 18:3027284-3027306 CCCACATTTTACATTATAACTAA No data
Right 1153240508 18:3027326-3027348 TTTTAGAAGCTATAGAGGGGAGG No data
1153240504_1153240508 18 Left 1153240504 18:3027285-3027307 CCACATTTTACATTATAACTAAA No data
Right 1153240508 18:3027326-3027348 TTTTAGAAGCTATAGAGGGGAGG No data
1153240502_1153240508 29 Left 1153240502 18:3027274-3027296 CCTTCATCATCCCACATTTTACA No data
Right 1153240508 18:3027326-3027348 TTTTAGAAGCTATAGAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153240508 Original CRISPR TTTTAGAAGCTATAGAGGGG AGG Intergenic
No off target data available for this crispr