ID: 1153265291

View in Genome Browser
Species Human (GRCh38)
Location 18:3262775-3262797
Sequence CTCGGTTACCGGCATGCTAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 15}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153265291_1153265294 -7 Left 1153265291 18:3262775-3262797 CCATTAGCATGCCGGTAACCGAG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1153265294 18:3262791-3262813 AACCGAGTGTGTGGTTGATACGG 0: 1
1: 0
2: 0
3: 6
4: 48
1153265291_1153265295 -6 Left 1153265291 18:3262775-3262797 CCATTAGCATGCCGGTAACCGAG 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1153265295 18:3262792-3262814 ACCGAGTGTGTGGTTGATACGGG 0: 1
1: 0
2: 0
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153265291 Original CRISPR CTCGGTTACCGGCATGCTAA TGG (reversed) Exonic