ID: 1153265393

View in Genome Browser
Species Human (GRCh38)
Location 18:3263732-3263754
Sequence GCTAATGTGTAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 327}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153265393_1153265398 7 Left 1153265393 18:3263732-3263754 CCTTCCTCATTCTACACATTAGC 0: 1
1: 0
2: 2
3: 29
4: 327
Right 1153265398 18:3263762-3263784 TGTCATTGCTTGTTATGCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 102
1153265393_1153265400 24 Left 1153265393 18:3263732-3263754 CCTTCCTCATTCTACACATTAGC 0: 1
1: 0
2: 2
3: 29
4: 327
Right 1153265400 18:3263779-3263801 CCCAGGTATCCACATTTTCATGG 0: 1
1: 0
2: 3
3: 16
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153265393 Original CRISPR GCTAATGTGTAGAATGAGGA AGG (reversed) Intronic
902853283 1:19178927-19178949 GATAATGTTTAGAGTGGGGAGGG - Intronic
903113961 1:21162629-21162651 GCTACTCTGTAGGCTGAGGAAGG + Intronic
903504576 1:23824441-23824463 GCTCATGTGTAAAATGAAGATGG - Intronic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904478442 1:30779140-30779162 GCTAATGTGTGGTCTGGGGAGGG - Intergenic
906096754 1:43229176-43229198 ACAAATGTGTCAAATGAGGAAGG - Intronic
906833765 1:49061070-49061092 GCAAAGGAGAAGAATGAGGAGGG + Intronic
907166954 1:52421049-52421071 TGTAATGTGTAAAATGATGATGG - Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907394646 1:54180687-54180709 CCTAATCTCTAGAATGAGGGTGG - Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907858084 1:58323540-58323562 GGGAATGTGGAGAATGAGAAAGG - Intronic
907935629 1:59039590-59039612 ACTAATTTGTAGAACAAGGAAGG + Intergenic
908202526 1:61812323-61812345 GCTAATGTGGTGATAGAGGAAGG + Intronic
908207668 1:61868068-61868090 GCTAAAGTGAAGTATGAGGGTGG - Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908581074 1:65517874-65517896 GTCAATGTGTGGAATGAAGAGGG - Intronic
909415438 1:75401046-75401068 GCCAGTGAGTAGAATGAGGGTGG - Intronic
909864047 1:80644146-80644168 GCTACTGTGGAGACTGAGGTGGG - Intergenic
912588120 1:110785561-110785583 GCTGGAGGGTAGAATGAGGAGGG + Intergenic
912774940 1:112500658-112500680 GCTAATCGGGAGACTGAGGAGGG + Intronic
912892436 1:113548914-113548936 GCTAATGTGTTGGATCTGGATGG + Intronic
913442473 1:118912686-118912708 GCTAATGGGAAGGAAGAGGATGG + Intronic
914449338 1:147776894-147776916 TCTATTGTATAGAAGGAGGAGGG - Intergenic
915243794 1:154542337-154542359 GCTACTGTGGAGGCTGAGGAGGG - Intronic
915723015 1:157997696-157997718 GCTCTTGTGTGAAATGAGGAGGG + Intronic
915928395 1:160041771-160041793 GGTAAGGGGTAGAATAAGGAAGG + Exonic
918843988 1:189584703-189584725 GCTACTCTGGAGACTGAGGAGGG + Intergenic
919690700 1:200526246-200526268 GCTACTCTGGAGAATGAGGCAGG - Intergenic
920736676 1:208539152-208539174 GCTAATGTGTAGAACAGGCAAGG - Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921445438 1:215241793-215241815 CCTAATATGTAAAATGACGATGG + Intergenic
922125249 1:222714699-222714721 GCTACTGGGAAGACTGAGGAGGG - Intronic
923385705 1:233463381-233463403 GCAAATATGAAGAATGAGTAGGG + Intergenic
924212424 1:241784548-241784570 GAAAATGTTTAGAATGTGGAAGG + Intronic
1063747361 10:8899713-8899735 GCTACTCTGTAGGATGAGGCAGG - Intergenic
1064610102 10:17090002-17090024 GCTACTGGGGAGACTGAGGAAGG + Intronic
1064814746 10:19246996-19247018 ACAAATGTGTATAATGAGAAAGG + Intronic
1065842149 10:29711286-29711308 GCTACTGTGGAGACTGAGGCAGG + Intronic
1066541787 10:36455325-36455347 GATAATGTGAAGACTGAAGATGG + Intergenic
1067017830 10:42771044-42771066 GCTACTGTGGAGGCTGAGGAAGG + Intergenic
1067185708 10:44025344-44025366 GCCCCTCTGTAGAATGAGGATGG + Intergenic
1070095710 10:73336486-73336508 AATAATTTGTAAAATGAGGATGG - Intronic
1070984902 10:80680276-80680298 GCAAATGTCCAAAATGAGGAGGG + Intergenic
1071321137 10:84459632-84459654 GCTAATTGGGAGAATGAGGTGGG - Intronic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072237096 10:93462887-93462909 GGTAATGTGGAGAAAGGGGAGGG - Intronic
1072825905 10:98605984-98606006 GCTAAGTTGAATAATGAGGAGGG - Intronic
1073299989 10:102465311-102465333 GCTACTGAGGAGACTGAGGAAGG + Intronic
1073497558 10:103907573-103907595 GAACATGTTTAGAATGAGGAAGG + Intronic
1073754333 10:106564992-106565014 GATAATGTGGAAAATGTGGAGGG + Intergenic
1073773502 10:106760993-106761015 GCTACTGGGAAGGATGAGGAAGG + Intronic
1075195793 10:120358046-120358068 GCTACTGTGGAGACTGAGGTGGG - Intergenic
1075746267 10:124730081-124730103 GCTACTGTGTGGCATGAGGAAGG - Intronic
1075852450 10:125600295-125600317 GCTCACGTGTAGGCTGAGGAGGG + Intronic
1075976621 10:126701680-126701702 GCCACAGTGTAGAAAGAGGAGGG - Intergenic
1078248318 11:9596445-9596467 GCTACTGTGGAGACTGAGGCAGG + Intergenic
1078796203 11:14594073-14594095 GCTAATGTTAATAATGAGAATGG + Intronic
1078981831 11:16544368-16544390 GCTACTTTGGAGAATGAGGTGGG - Intronic
1079471105 11:20778376-20778398 CCTGATGTATAGAGTGAGGATGG - Intronic
1080509043 11:32948515-32948537 GCTAATGTGGAGCCTGAGGCAGG + Intronic
1080561757 11:33470538-33470560 GCTACTCTGTAGGGTGAGGAGGG - Intergenic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082901461 11:58257681-58257703 GCTACTGTAGAAAATGAGGAGGG - Intergenic
1085533466 11:77204811-77204833 GCTGATGTGTAGTTTGAGGATGG - Intronic
1085634768 11:78150162-78150184 GCTACTGGGAAGAATGAGGCAGG - Intergenic
1085758199 11:79219062-79219084 CCTAATGTGTGGACAGAGGATGG + Intronic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1086842820 11:91708606-91708628 GTCAATCTGTAGAATGAGTAAGG - Intergenic
1087595121 11:100243822-100243844 GCTAATTTGGAGACTGAAGAGGG - Intronic
1087920237 11:103858587-103858609 TGTAATCTGTAAAATGAGGAAGG + Intergenic
1089749820 11:120643023-120643045 GTAAATGTGTTGAATGAGTATGG - Intronic
1090681212 11:129059431-129059453 ACTAATGTGTAGAAACAGCAAGG + Intronic
1095054120 12:37580360-37580382 GCTACTATGTAGGCTGAGGAGGG + Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096645396 12:53031386-53031408 GCTACTGGGGAGGATGAGGAAGG - Intronic
1096756940 12:53807549-53807571 GCTGAAGAGAAGAATGAGGAAGG - Intergenic
1098269748 12:68758306-68758328 GCTACTCAGGAGAATGAGGAAGG + Intronic
1099458469 12:82894007-82894029 GATAATGAGTGGAATGTGGAGGG + Intronic
1101699019 12:107154181-107154203 TTGAATGTGGAGAATGAGGATGG - Intergenic
1102133161 12:110549738-110549760 TCTAAAGTGTAAAATCAGGATGG + Intronic
1103292670 12:119859926-119859948 GCTACTCTGGAGAATGAGGTGGG - Intronic
1103598479 12:122038804-122038826 TTTAATCTGTAGAATGGGGATGG + Intronic
1104175816 12:126331668-126331690 GCTACAGTGTAGAATTGGGAGGG + Intergenic
1105013280 12:132770119-132770141 GCTACTGGGGAGAATGAGGCAGG + Exonic
1106103628 13:26715351-26715373 GCTACTCTGGAGACTGAGGAGGG + Intergenic
1106883194 13:34153990-34154012 GCTCATGTGTGTAATGAGGAAGG - Intergenic
1107571895 13:41670291-41670313 ACTAATTTGAAGAATGAGGAAGG - Intronic
1108235526 13:48399954-48399976 GGTAATGTGTATAATATGGATGG - Intronic
1110640937 13:77822988-77823010 GCTCGTGTGGAGAATGAAGAAGG - Intergenic
1113010171 13:105755393-105755415 GCTCATGTATTGAATGAGAAAGG + Intergenic
1113241027 13:108337255-108337277 GTTAAAGTGTAAAATGTGGATGG - Intergenic
1113645995 13:111996373-111996395 GGGAATGTGGGGAATGAGGAGGG - Intergenic
1114054255 14:18952882-18952904 GCTAATGGGGAGACTGAGGCTGG - Intergenic
1114108300 14:19449050-19449072 GCTAATGGGGAGACTGAGGCTGG + Intergenic
1114869537 14:26639607-26639629 GCTACTCTGGAGACTGAGGAGGG + Intergenic
1115658678 14:35468484-35468506 GCTGATCTGCAGAATGATGAAGG + Intergenic
1116607566 14:47021287-47021309 GCTTCTGTTTAGAATGAGGATGG - Intronic
1117738015 14:58787378-58787400 ACTAATGTGAAGAATGAGAAAGG - Intergenic
1118827038 14:69393203-69393225 GCTACTGAGGAGACTGAGGAAGG + Intronic
1119060536 14:71469693-71469715 TCTCATGTGAAAAATGAGGAAGG + Intronic
1119637015 14:76281606-76281628 GCTATTGTGAAGAATGAACATGG - Intergenic
1120116482 14:80624078-80624100 GGTACTGTGAAGATTGAGGAAGG - Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121151559 14:91639895-91639917 TCCAATGTGTAGAATGAGCTAGG - Intronic
1123630304 15:22256474-22256496 GCTACTGGGTAGACTGAGGCAGG - Intergenic
1125070593 15:35548506-35548528 GGTAATGGCTGGAATGAGGATGG + Intergenic
1125965054 15:43867618-43867640 GCTACTGCTTAGAATGAAGAAGG + Exonic
1126181968 15:45794089-45794111 GCTGATGTGAGGAATGAGAAAGG + Intergenic
1126865676 15:52934248-52934270 GCTACTGTGTCCAAGGAGGATGG + Intergenic
1127351288 15:58155234-58155256 GCCAATGTGTAGGAAGAGGCAGG - Intronic
1127911482 15:63419802-63419824 GCTCAGGTGTAGAACCAGGAAGG - Intergenic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1130097520 15:80867078-80867100 GCAAATCTGTAAAATGGGGAGGG + Intronic
1130780548 15:87034014-87034036 GGTACTGTGTGGAATGAGCAAGG - Intergenic
1131753901 15:95539796-95539818 GCAAATGAGTGGAATGAGCAGGG + Intergenic
1132044107 15:98549353-98549375 GCTCATGTCTATAATGAGGGAGG - Intergenic
1132914627 16:2337022-2337044 GCTACTGTGGAGGCTGAGGAGGG - Intronic
1133182081 16:4064582-4064604 GCTAATGGGGAGACTGAGGTGGG - Intronic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133749739 16:8715096-8715118 GCAAATGTGGAGAAAGAGGTCGG - Intronic
1134537337 16:15036570-15036592 GCTTATGTTTAGAAAGAGCAAGG - Exonic
1137753301 16:50882348-50882370 GCTTCTGAGTATAATGAGGATGG - Intergenic
1138331151 16:56216454-56216476 GCAAATGTGAAGAATGAAGAAGG - Intronic
1138748609 16:59392683-59392705 TCTAATGAATAAAATGAGGAAGG + Intergenic
1139565123 16:67769951-67769973 GCTAAAGGGGAGAATGAGGTGGG + Intronic
1139738092 16:69010307-69010329 GATAATGTGTTCACTGAGGATGG - Intronic
1140115590 16:72038627-72038649 TCCAATGTGTAGAATGAGGCTGG - Intergenic
1140255653 16:73334077-73334099 GCTTATGTGCTGAAAGAGGAAGG + Intergenic
1140892547 16:79297678-79297700 CATAATGTGAAGAATGAGAATGG - Intergenic
1142215916 16:88829744-88829766 CCTGATGTGTAGAATGAGTGGGG + Intronic
1144534431 17:16074101-16074123 GCTAATGTGTAGAGTGGAGTTGG + Intronic
1145377071 17:22360622-22360644 GCTACTCTGGAGAATGAGGCAGG - Intergenic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146173845 17:30652284-30652306 GCTACTGAGTAGACTGAGGCAGG - Intergenic
1146347301 17:32068306-32068328 GCTACTGAGTAGACTGAGGCAGG - Intergenic
1147961835 17:44172249-44172271 GCTAATGTGCTGACTGAGGAGGG + Exonic
1148034019 17:44644418-44644440 GCTACTGGGGAGAATGAGGCTGG + Intergenic
1148142880 17:45340785-45340807 GCTAATGGGTAGACTGAGGCAGG - Intergenic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148647846 17:49229615-49229637 GGAAATGTGCAGAATGAGGATGG + Intronic
1149120759 17:53161307-53161329 GCTACTGAGTAGGCTGAGGAAGG - Intergenic
1150631339 17:66882501-66882523 GCTGGTGTGTAGAGTGAGAAGGG + Intronic
1152323339 17:79621429-79621451 GAAAATGTGTAGATTCAGGATGG - Intergenic
1152863955 17:82711222-82711244 GCTAATGAGTAGGATGAGTTTGG - Intergenic
1153265393 18:3263732-3263754 GCTAATGTGTAGAATGAGGAAGG - Intronic
1153466088 18:5389374-5389396 GCTGATCTGTAAAATCAGGAAGG + Intergenic
1155403240 18:25461169-25461191 GCTAATCTGTAGGCTGAGGTGGG + Intergenic
1155556338 18:27023330-27023352 GCTATTGTGTAACATGTGGATGG - Intronic
1155765234 18:29621772-29621794 GATTAAGTGTGGAATGAGGATGG + Intergenic
1156740124 18:40315743-40315765 GTTAAGGTGTACAAAGAGGAAGG + Intergenic
1158551493 18:58439905-58439927 GCTACTCTGGAGACTGAGGAAGG - Intergenic
1158861101 18:61593181-61593203 GCTGATGTGTGGAAAGTGGATGG - Intergenic
1159280905 18:66284195-66284217 GCTAATGTATAGAAAAATGATGG + Intergenic
1159541186 18:69778910-69778932 CCTAATGAGTGGAATGGGGATGG + Intronic
1159973984 18:74687411-74687433 GGAAAGGTGTAGCATGAGGAAGG + Intronic
1161509636 19:4663297-4663319 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509654 19:4663384-4663406 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509665 19:4663431-4663453 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509686 19:4663517-4663539 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509756 19:4663781-4663803 GAGGCTGTGTAGAATGAGGATGG - Intronic
1163623464 19:18374429-18374451 GCTAATGTGGAGCGTGAAGAGGG + Intergenic
1165914507 19:39249375-39249397 GCTACTATGGAGAATGAGGTGGG - Intergenic
1166600138 19:44086506-44086528 ACAAATGTGAAGAATGTGGAAGG + Exonic
1167260896 19:48457105-48457127 GCTACTGTGGAGACTGAGGTGGG - Intronic
925850137 2:8073122-8073144 CCTAATGTGTAGAAAGGAGAAGG - Intergenic
928216691 2:29367411-29367433 GCTAATCTGTAAAATGAGGGAGG + Intronic
928746046 2:34417055-34417077 GCTAGTGTGTAGTAGGAGAATGG + Intergenic
929274224 2:40007848-40007870 GCCATTGTAAAGAATGAGGATGG + Intergenic
929720604 2:44363487-44363509 GCTACTGGGGAGACTGAGGAAGG - Intronic
929952145 2:46420503-46420525 GCTACTTGGTAGACTGAGGAGGG + Intergenic
929954104 2:46442484-46442506 GCTCATGTGTAAACTGGGGATGG + Intronic
930031765 2:47062485-47062507 GCTAATGTCTAAATTGAGGGAGG - Intronic
930963530 2:57290569-57290591 GCTAATTTGTAGGTTAAGGAGGG - Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
933822083 2:86122521-86122543 GCTATTTGGGAGAATGAGGAAGG - Intronic
934684337 2:96309594-96309616 GCTAATGAGGAGACTGAGGCAGG - Intergenic
936139462 2:109926696-109926718 GCTACTCTGGAGACTGAGGATGG + Intergenic
936205234 2:110444790-110444812 GCTACTCTGGAGACTGAGGATGG - Intronic
936685747 2:114824123-114824145 TCTTATGTGTGGAATGAAGAGGG + Intronic
938697279 2:133845593-133845615 GCTAATGGGAAGCAAGAGGAAGG + Intergenic
940409021 2:153338179-153338201 GCTACTCTGGAGGATGAGGAGGG + Intergenic
940440171 2:153706106-153706128 GCTAATGTGGAGGCTGAGGCAGG - Intergenic
942030710 2:171956062-171956084 GCTACTGAGGAGAATGAGGCAGG + Intronic
942822436 2:180130945-180130967 GATAATGTTTAAAATGAGGAAGG - Intergenic
943984242 2:194599382-194599404 TCTAATATGTAAAATGAAGATGG - Intergenic
944991588 2:205243481-205243503 TCTCATCTGTAGAATGAGAATGG + Intronic
945363152 2:208916771-208916793 CATCTTGTGTAGAATGAGGAAGG - Intergenic
947249423 2:228084779-228084801 GCTTAGGTGAAGAATGAGAAAGG + Intronic
1169150973 20:3289098-3289120 GCTACTTTGTAGAATGAGGTGGG + Intronic
1172131563 20:32659495-32659517 GCTCATCTGTACAATGAAGATGG - Intergenic
1172423457 20:34837216-34837238 GCTATTGTGGAGACTGAGGTGGG + Intergenic
1172476344 20:35241062-35241084 GCTAATGTGCATAAAGAGAATGG + Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1174813223 20:53665258-53665280 GCTAATTTGGAGGATGAGGCAGG - Intergenic
1176933045 21:14836537-14836559 GCTAATTGGGAGAATGAGGTAGG - Intergenic
1177070896 21:16506335-16506357 GCTATTGTTTATAATGAGGATGG - Intergenic
1177999469 21:28143388-28143410 GCAGATGGGTAGAATGAGGCTGG - Intergenic
1180472727 22:15675261-15675283 GCTAATGGGGAGACTGAGGCTGG - Intergenic
1181013446 22:20055369-20055391 GCTAATCTGGAGACTAAGGAGGG - Intronic
1182404663 22:30115784-30115806 GCTGAAGTGGAGAATGAAGAAGG + Intronic
1182942703 22:34293038-34293060 ACTGCTGTGTATAATGAGGACGG + Intergenic
1183146253 22:35995358-35995380 GCAAATGTGTTAAATGGGGAAGG - Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
951092832 3:18595456-18595478 GCTAATGGGGAGGCTGAGGAGGG - Intergenic
951928745 3:27940019-27940041 GCTAGTGTGTGGAATGTGAATGG + Intergenic
953454403 3:43030403-43030425 GCTCAAGTGTAGAGTGAGAATGG + Intronic
953997245 3:47529425-47529447 GCTACTGTGTAGGTTGAGGCGGG + Intergenic
955116341 3:56008330-56008352 CCTGATGTGAAGAATGAGAATGG - Intronic
955259809 3:57376085-57376107 GCTTATCTGTAAAATGAGGTTGG + Intronic
956421959 3:69094826-69094848 GCTTACGTGTAAAATGAGGTGGG + Intronic
956553009 3:70482952-70482974 GCAAATCTGGAGAATGAGAAAGG + Intergenic
956758276 3:72412230-72412252 GCTAATATGGAAAATAAGGACGG - Intronic
956935378 3:74095015-74095037 GCTAATATCTATAATGAGCAAGG + Intergenic
958539639 3:95454242-95454264 GCTATTGGGAAGGATGAGGAAGG - Intergenic
959362639 3:105413421-105413443 GCAAATGTGTAGAGAGAAGATGG - Intronic
960997238 3:123348281-123348303 GCTCGTCTGTAAAATGAGGATGG + Intronic
963140109 3:141939873-141939895 GCTACTGTGGAGACTGAGGTGGG + Intergenic
963232612 3:142924286-142924308 GCTTATTAGTAGAATGAGCATGG - Intergenic
963747227 3:149136615-149136637 CCTGATGTATAAAATGAGGAGGG + Intronic
966746622 3:183283114-183283136 GAAAATGTGTAGAATGAAGGAGG - Intronic
967127824 3:186441309-186441331 GCTAATGGCAAGAATGAGAACGG - Intergenic
967535035 3:190592370-190592392 GCTGTTGTGCAGAATAAGGAAGG - Intronic
969362944 4:6676811-6676833 GCTGATGTGTGGAATGTGCATGG + Intergenic
970022883 4:11588887-11588909 TCTAATGTATAGCATGAGGATGG - Intergenic
970026579 4:11630378-11630400 GCTCATGTGTAAAATGAAGGAGG + Intergenic
970592882 4:17575039-17575061 GCTAATGGGGAGACTGAGGTAGG - Intergenic
970947720 4:21714663-21714685 GCAAATGTGTTGAATGGGGAAGG - Intronic
971152427 4:24047579-24047601 GCTAGTGTGTAAAGTGAGGCAGG + Intergenic
971290756 4:25336829-25336851 GCTAATGTGAGGAATGAGTCAGG - Intronic
971321624 4:25610589-25610611 GCTACTGAGTAGACTGAGGCAGG - Intergenic
971887154 4:32465060-32465082 GCTACTTTGTAGACTGAGGTGGG + Intergenic
972897980 4:43646167-43646189 GCTACTCTGGAGAATAAGGAGGG + Intergenic
972987831 4:44786321-44786343 GCTACTGTGGAGGCTGAGGAGGG + Intergenic
973061599 4:45733145-45733167 TCTGATTTCTAGAATGAGGAAGG - Intergenic
973965846 4:56161269-56161291 GGCAATGTGTAAAATTAGGAGGG + Intergenic
977858137 4:101920935-101920957 GATAAAGAGAAGAATGAGGAAGG + Intronic
979678061 4:123431115-123431137 GCAAATGTGTAGAATCAGAAGGG + Intergenic
979706959 4:123731743-123731765 GCTGATTTGTAGAATGAGTTAGG + Intergenic
981140773 4:141266087-141266109 GCTACTGGGGAGAATGAGGCAGG + Intergenic
983001597 4:162421139-162421161 GAGAATGTGTACAATGAGAAGGG - Intergenic
983160260 4:164404688-164404710 TCTAATATGTAAAATGAAGATGG - Intergenic
983405895 4:167329375-167329397 GCTAATCTGGAGACTGAGGTGGG + Intergenic
984682614 4:182627288-182627310 CTTAATGTATAAAATGAGGATGG - Intronic
985101062 4:186459129-186459151 GAAAATGTGTTGACTGAGGATGG - Intronic
986316984 5:6596025-6596047 TCTGATGTATAGAATGACGATGG - Intergenic
986320429 5:6628031-6628053 TTTAATGTCTAGATTGAGGATGG - Intronic
987211973 5:15692834-15692856 GAAGATGTGAAGAATGAGGAAGG + Intronic
987900656 5:24006984-24007006 GCTACTGTGGAGGCTGAGGAGGG + Intronic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
989761708 5:45023683-45023705 GCTACTGGGGAGACTGAGGAAGG - Intergenic
990724790 5:58741438-58741460 GCTAATGTGATGACTCAGGATGG - Intronic
991603693 5:68379161-68379183 GCTACTTGGGAGAATGAGGAAGG + Intergenic
992438828 5:76780581-76780603 GCTACTCTGGAGAATGAGGTGGG + Intergenic
992563122 5:77972399-77972421 ACTAATGTGCAGGATGAGAACGG - Intergenic
993097794 5:83500489-83500511 TTTCATGAGTAGAATGAGGAAGG + Intronic
993394691 5:87370548-87370570 GCCACTGGGTAGAATGAGGCAGG + Intronic
993803056 5:92369000-92369022 GGAAATGTCTAGAATTAGGATGG + Intergenic
995545878 5:113230017-113230039 GCTAATGTGTAGTCAAAGGATGG + Intronic
995624645 5:114063140-114063162 GCTAGAGTGTGGAATGAGGGAGG - Intergenic
997144333 5:131416193-131416215 GTTTATGTGTAGTATGAGGTAGG - Intergenic
998359042 5:141568669-141568691 GCAAATGTGCAGAGTGAGGCAGG + Intronic
999146585 5:149399969-149399991 GCTACTGTGAAGAAGCAGGAAGG - Intronic
999710525 5:154314428-154314450 ACTGAGGTCTAGAATGAGGAGGG - Intronic
1000199787 5:158997068-158997090 GCTTTTGTGGAGGATGAGGAGGG - Intronic
1002498618 5:179632967-179632989 GCTAGTGGGGAGAATGAGGCTGG - Intronic
1002682076 5:180973805-180973827 GCTAATGGGGAGGCTGAGGAGGG + Intergenic
1003134638 6:3424949-3424971 GCTAATGCTCAGAATGAGGGAGG + Intronic
1003843179 6:10143833-10143855 GCTAATATTTACAATGAAGAAGG - Intronic
1007156189 6:39746604-39746626 GCTAAGGAGTAGGAAGAGGAAGG - Intergenic
1007773857 6:44212914-44212936 GCTACTGTGGAGACTGAGGTGGG + Intergenic
1007970138 6:46043780-46043802 ACCAATGTGAAAAATGAGGAGGG + Intronic
1008119001 6:47588717-47588739 GATAAAGTGTACACTGAGGATGG - Intronic
1008947693 6:57116851-57116873 GCTACTCTGTAGGATGAGGTGGG + Intronic
1010136623 6:72561768-72561790 GCGATTGTGTTGAATGAGAAAGG - Intergenic
1011106884 6:83791989-83792011 GCTAATGTGTAGGAAAAGGAAGG + Intergenic
1011854165 6:91668064-91668086 GAGAATGTGTAGAATAATGAGGG - Intergenic
1012574167 6:100770620-100770642 GCTAATGTGTGAATTCAGGAAGG + Intronic
1013595933 6:111661174-111661196 GCTAATGTGGAGACTGTGGCCGG - Exonic
1013846557 6:114459707-114459729 GATAATGTGTGGAAGAAGGATGG + Intergenic
1015000577 6:128209542-128209564 TTTAATGTGTAGAATGAGGAGGG - Intronic
1015306535 6:131715293-131715315 GCTTATGTGTAGAATGGAGAAGG - Intronic
1015797510 6:137027728-137027750 ACTAAGCTGTAAAATGAGGATGG - Intronic
1016733544 6:147451796-147451818 GATATTGAGTAGCATGAGGAGGG + Intergenic
1017909499 6:158780931-158780953 GCTTATGTGTACAATGAAAAGGG + Intronic
1020832569 7:13110173-13110195 GCTAATGGGTAGAAAGGGGTGGG - Intergenic
1020901456 7:14008512-14008534 GCTACTTTTTGGAATGAGGAAGG + Intergenic
1023714459 7:43029170-43029192 GCTGAGGTGGAGAATGAGGTGGG + Intergenic
1023720460 7:43088265-43088287 TCTAATGAGTAGAATGTGGCAGG + Intergenic
1025930093 7:65986541-65986563 GCTAATGGGGAGGCTGAGGAAGG + Intergenic
1026953330 7:74361695-74361717 CCTGATGTGTAAAATGAGAATGG - Intronic
1027654661 7:80915628-80915650 GCTACTGGGTAGGCTGAGGAAGG + Intronic
1028660017 7:93260805-93260827 GCTATTCTGGAGAATGAGGCAGG - Intronic
1029684624 7:102138070-102138092 GCTACTTTGGAGACTGAGGAGGG + Intronic
1029731750 7:102442906-102442928 GCTATTGGGGAGACTGAGGAAGG + Intronic
1030555445 7:111019139-111019161 ATAAATGTGTTGAATGAGGATGG + Intronic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1032544874 7:132733658-132733680 GCTACTCTGGAGACTGAGGATGG + Intergenic
1033205635 7:139419377-139419399 GCAAATGCAGAGAATGAGGAGGG + Intronic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033679792 7:143583234-143583256 GCTTATATGTAGAATGGAGAAGG - Intergenic
1033692043 7:143746209-143746231 GCTTATATGTAGAATGGAGAAGG + Intergenic
1033731014 7:144179207-144179229 GCTTATGTGTAGAATGGAGAAGG + Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035514636 8:222199-222221 GCTACTAGGGAGAATGAGGAAGG + Intergenic
1035638830 8:1167022-1167044 GCTAATCTGTAGGCTGAGGTGGG + Intergenic
1037256535 8:16961778-16961800 GCTACTGTGGAGACTGAGGTAGG - Intergenic
1038199009 8:25394323-25394345 GATAATGGGTAAAATGAAGAAGG + Intronic
1038327617 8:26584382-26584404 GCTTCTTTTTAGAATGAGGATGG + Intronic
1039225877 8:35387698-35387720 GTTCATGTGTAGGATTAGGAGGG + Intronic
1039906932 8:41793266-41793288 GCTAATCTGGAGGCTGAGGAAGG + Intronic
1040070414 8:43182553-43182575 GCTAATTAGGAGACTGAGGAGGG - Intronic
1041832372 8:62169150-62169172 TCTAGTGTGAAGAATGATGATGG - Intergenic
1042636123 8:70877414-70877436 TGTAATCTGTAAAATGAGGATGG - Intergenic
1043146691 8:76665651-76665673 GCTAATGTGCAGATTGGGTACGG - Intergenic
1045446372 8:102268956-102268978 GGTAATGTGTACAATTGGGAAGG - Exonic
1045524405 8:102929597-102929619 GCTAATGTTTAAACAGAGGAGGG - Intronic
1045528608 8:102962933-102962955 GCTACTGTGGAGACTGAGGCGGG - Intronic
1047473566 8:125203342-125203364 ACTAATATCTAGAAAGAGGAAGG + Intronic
1047576372 8:126160236-126160258 TCCAATGGGTAGAATGAGGATGG + Intergenic
1049129424 8:140824331-140824353 GTTAATGTGTAGGATGAGCAAGG - Intronic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1049869951 8:144966706-144966728 GCTACTGTGGAGGCTGAGGAAGG + Intergenic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050253903 9:3774190-3774212 GCTGATGTGTTAAATGAGTAAGG + Intergenic
1052963951 9:34324734-34324756 ACTAAACTGTAGAGTGAGGAAGG - Intronic
1053011146 9:34634354-34634376 GCTACTCTGGAGACTGAGGAAGG + Intergenic
1053298501 9:36932159-36932181 GCTATTTTGGAGAATGAGGCAGG + Intronic
1053407586 9:37890939-37890961 GCATGTGTGTAGTATGAGGAGGG - Intronic
1055151716 9:73008639-73008661 GCTATTGTCTAGAAAGATGAAGG + Intronic
1055309959 9:74968349-74968371 GCTAATCTGGAGGCTGAGGAGGG + Intergenic
1055766066 9:79664741-79664763 GCTGAAGTCTAGAAGGAGGATGG - Intronic
1056071103 9:82987793-82987815 TCTAATCTGTAAAATGAGGGAGG - Intronic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058802414 9:108557641-108557663 GCTAATGAGTAGAATTTGCATGG + Intergenic
1058956068 9:109949951-109949973 GCTTATGTGTAGACTGAAGATGG - Intronic
1059993291 9:119885419-119885441 TCTCATTTGTAGAATGAGGGGGG - Intergenic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060225304 9:121786665-121786687 GCTGATGTGGAGGATGAGCAGGG - Intergenic
1061676279 9:132217744-132217766 TCTAATCTGTAAAATAAGGATGG - Intronic
1185833878 X:3327542-3327564 TCTTATGTGTAGAAAGAGGCAGG - Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187953789 X:24495842-24495864 GCTAATGTGGTGACTTAGGACGG - Intronic
1188512637 X:30953185-30953207 GCTACTGGGTAGGCTGAGGAAGG - Intronic
1189307691 X:39999362-39999384 GGTAACGTGTAAAATGTGGAAGG + Intergenic
1189312625 X:40030627-40030649 GCTACTCTGTAGGCTGAGGAGGG + Intergenic
1189529442 X:41864409-41864431 GCTAATGTGTAATATGAGTACGG - Intronic
1190835208 X:54094463-54094485 GCTAATCTTTAGAATGAGGATGG + Intronic
1192146694 X:68687443-68687465 GCTACTTTGGAGACTGAGGAGGG - Intronic
1193042471 X:77017972-77017994 GCTAATGAGTGCAATTAGGAAGG + Intergenic
1193492300 X:82165108-82165130 GCTTAAGTGTAGAATGCGCAGGG + Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1194918570 X:99734788-99734810 GCTACTCTGTAGGCTGAGGAAGG + Intergenic
1196692170 X:118571594-118571616 ACTAATATGTAGACCGAGGAGGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic