ID: 1153278226

View in Genome Browser
Species Human (GRCh38)
Location 18:3390058-3390080
Sequence TAGTATACACAACCAAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153278226_1153278227 1 Left 1153278226 18:3390058-3390080 CCTTGTTTTGGTTGTGTATACTA No data
Right 1153278227 18:3390082-3390104 GTAGTAATCCTAAAACTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153278226 Original CRISPR TAGTATACACAACCAAAACA AGG (reversed) Intergenic
No off target data available for this crispr