ID: 1153280487

View in Genome Browser
Species Human (GRCh38)
Location 18:3410067-3410089
Sequence GCTCAGAGCAGTCTGTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153280484_1153280487 -6 Left 1153280484 18:3410050-3410072 CCGGGTGAATGGGAACCGCTCAG No data
Right 1153280487 18:3410067-3410089 GCTCAGAGCAGTCTGTTGGCAGG No data
1153280478_1153280487 25 Left 1153280478 18:3410019-3410041 CCTCATTGGCATAATCCTTTAGA No data
Right 1153280487 18:3410067-3410089 GCTCAGAGCAGTCTGTTGGCAGG No data
1153280481_1153280487 10 Left 1153280481 18:3410034-3410056 CCTTTAGACAGCTGTACCGGGTG No data
Right 1153280487 18:3410067-3410089 GCTCAGAGCAGTCTGTTGGCAGG No data
1153280477_1153280487 30 Left 1153280477 18:3410014-3410036 CCTCTCCTCATTGGCATAATCCT No data
Right 1153280487 18:3410067-3410089 GCTCAGAGCAGTCTGTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153280487 Original CRISPR GCTCAGAGCAGTCTGTTGGC AGG Intergenic
No off target data available for this crispr