ID: 1153280606

View in Genome Browser
Species Human (GRCh38)
Location 18:3411065-3411087
Sequence GCTTCTAAATGAGCACGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153280606_1153280611 12 Left 1153280606 18:3411065-3411087 CCTATGCGTGCTCATTTAGAAGC No data
Right 1153280611 18:3411100-3411122 CTTCACCTCCCAGGTAGCAGGGG 0: 2
1: 0
2: 8
3: 70
4: 890
1153280606_1153280607 3 Left 1153280606 18:3411065-3411087 CCTATGCGTGCTCATTTAGAAGC No data
Right 1153280607 18:3411091-3411113 TCTGCTCCTCTTCACCTCCCAGG No data
1153280606_1153280613 17 Left 1153280606 18:3411065-3411087 CCTATGCGTGCTCATTTAGAAGC No data
Right 1153280613 18:3411105-3411127 CCTCCCAGGTAGCAGGGGAAAGG 0: 2
1: 0
2: 2
3: 30
4: 363
1153280606_1153280609 10 Left 1153280606 18:3411065-3411087 CCTATGCGTGCTCATTTAGAAGC No data
Right 1153280609 18:3411098-3411120 CTCTTCACCTCCCAGGTAGCAGG 0: 2
1: 0
2: 17
3: 248
4: 2759
1153280606_1153280610 11 Left 1153280606 18:3411065-3411087 CCTATGCGTGCTCATTTAGAAGC No data
Right 1153280610 18:3411099-3411121 TCTTCACCTCCCAGGTAGCAGGG 0: 2
1: 1
2: 8
3: 168
4: 2500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153280606 Original CRISPR GCTTCTAAATGAGCACGCAT AGG (reversed) Intergenic
No off target data available for this crispr