ID: 1153280753

View in Genome Browser
Species Human (GRCh38)
Location 18:3411930-3411952
Sequence TCCCGCCCGCATCTCGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 53}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153280747_1153280753 -8 Left 1153280747 18:3411915-3411937 CCTTCCGGGAGTGACTCCCGCCC 0: 1
1: 0
2: 0
3: 5
4: 96
Right 1153280753 18:3411930-3411952 TCCCGCCCGCATCTCGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1153280746_1153280753 -5 Left 1153280746 18:3411912-3411934 CCTCCTTCCGGGAGTGACTCCCG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1153280753 18:3411930-3411952 TCCCGCCCGCATCTCGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1153280745_1153280753 3 Left 1153280745 18:3411904-3411926 CCTACGCTCCTCCTTCCGGGAGT 0: 1
1: 0
2: 0
3: 13
4: 93
Right 1153280753 18:3411930-3411952 TCCCGCCCGCATCTCGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1153280742_1153280753 20 Left 1153280742 18:3411887-3411909 CCTGGAAGAGCATCTGTCCTACG 0: 1
1: 0
2: 1
3: 7
4: 75
Right 1153280753 18:3411930-3411952 TCCCGCCCGCATCTCGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1153280740_1153280753 30 Left 1153280740 18:3411877-3411899 CCTCTTCCAGCCTGGAAGAGCAT 0: 1
1: 0
2: 1
3: 29
4: 257
Right 1153280753 18:3411930-3411952 TCCCGCCCGCATCTCGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1153280741_1153280753 24 Left 1153280741 18:3411883-3411905 CCAGCCTGGAAGAGCATCTGTCC 0: 1
1: 0
2: 1
3: 22
4: 206
Right 1153280753 18:3411930-3411952 TCCCGCCCGCATCTCGGGGTGGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153280753 Original CRISPR TCCCGCCCGCATCTCGGGGT GGG Intronic
902798263 1:18813849-18813871 TCCTGCCCCCGTCTCGGGGAAGG - Intergenic
904775059 1:32901365-32901387 TCCCGCCCGGAGCCCGGGGCTGG + Intronic
906675722 1:47692381-47692403 TCCGGCACGCATTTCGGTGTTGG - Intergenic
916481517 1:165218818-165218840 TCCAGCCTGCATCTGGGAGTGGG - Intronic
916773446 1:167936197-167936219 CCCCGCCCGCGCCTCGGGGCGGG - Intronic
1076215456 10:128689670-128689692 TCCCGCCCACATCTCCGCATGGG + Intergenic
1076898489 10:133325660-133325682 GCCCGCCAGAACCTCGGGGTTGG - Intronic
1081831563 11:46120286-46120308 CCCCGACAGCATCCCGGGGTGGG + Intronic
1090780674 11:130003411-130003433 TCCCGCCCGGCTCCCGGAGTCGG + Intergenic
1102992513 12:117325192-117325214 TCCAGGCTGCATGTCGGGGTGGG - Intronic
1109557877 13:64004282-64004304 TCCCTCCTCAATCTCGGGGTGGG + Intergenic
1117086214 14:52204351-52204373 TCCCATCAGCATCTCGGGGTTGG + Intergenic
1118607737 14:67515567-67515589 TGCCTCCCGCAGCCCGGGGTCGG + Intronic
1132584239 16:699401-699423 TCCTCCCCGGATGTCGGGGTGGG - Intronic
1134121268 16:11586654-11586676 TCCCGGCCGCGTCTCCGGTTGGG - Intronic
1139949670 16:70662964-70662986 TCCAGCCAGCCTCACGGGGTGGG + Exonic
1141731575 16:85826360-85826382 TCCTGCCCGCATCTGAGAGTGGG - Intergenic
1142995114 17:3755392-3755414 TCCCGCCTGCATCTCTGGCCAGG - Intronic
1143563871 17:7709885-7709907 TCCCGCCCCTAGCTCTGGGTGGG - Exonic
1148439512 17:47704418-47704440 TCCCGCCCGACCCTCGGGGAGGG - Intronic
1152738393 17:82008543-82008565 TCCCTCCCGCATCCCAGGGTGGG + Intronic
1152895692 17:82909824-82909846 ACCCGGCCAGATCTCGGGGTTGG - Intronic
1153280753 18:3411930-3411952 TCCCGCCCGCATCTCGGGGTGGG + Intronic
1153688500 18:7568301-7568323 GCCCGGCCGCTGCTCGGGGTCGG - Intronic
1160164940 18:76502472-76502494 TCCCGCCCGTCTCTCAGAGTTGG + Intergenic
1162523910 19:11196909-11196931 TCCCGCCCCAAACTCGGGGTGGG + Intronic
1162580817 19:11529193-11529215 TCCCGCCCACAACGCGAGGTGGG + Intergenic
928131385 2:28653817-28653839 TGCCACCTGCATCTGGGGGTGGG + Intergenic
935953190 2:108349658-108349680 CCCCGCTCTCATCACGGGGTAGG + Intergenic
947641698 2:231710666-231710688 TCCCGACAGCACCTCGGGGGTGG - Intronic
1171985993 20:31661738-31661760 CCCCGCCCGCTTTTCGGAGTGGG - Intergenic
1179960546 21:44765003-44765025 CCCCGCCCACCTCTCGGGGCAGG - Intergenic
1182288028 22:29259467-29259489 GCCCTCCCGCATCTCAGGTTGGG + Exonic
1183391165 22:37546314-37546336 CCCCGCCCGCAACACGGGATGGG - Intergenic
1183472634 22:38017623-38017645 TCCCGTCAGCATCTCAGGGCTGG + Intronic
954004363 3:47579337-47579359 TCCCGCCCGGAACACGGGATTGG - Exonic
968756478 4:2418692-2418714 CCCCGCCCGCAGCGCGCGGTGGG - Intergenic
981746066 4:148053463-148053485 TCCCGCCCGCATCTCAGCCAAGG - Intronic
985631348 5:1015695-1015717 TGCCGCCAGCATTTCAGGGTGGG + Intronic
986721508 5:10564040-10564062 TGCCGCCCGCGACTCGGGTTCGG + Intergenic
988182500 5:27815976-27815998 GCCCGCCCGCATCTTGGGAGCGG - Intergenic
990003794 5:50922779-50922801 TCTCACCCGCATCGCGGGGAGGG + Intergenic
992939586 5:81750266-81750288 TCCCCCGCGCATCGCGGGGCTGG - Intronic
1022843678 7:34189691-34189713 TCCTGCCCACATCTCGGGAAAGG + Intergenic
1029270517 7:99374593-99374615 TCCCGCCCTCCCTTCGGGGTGGG - Intronic
1033361414 7:140640964-140640986 GCCCCCTCGCCTCTCGGGGTGGG + Intronic
1034020032 7:147632347-147632369 TCCCTCCCGCAACACTGGGTTGG - Intronic
1034698399 7:153075303-153075325 TCCCTCCTGCCTCTCTGGGTGGG + Intergenic
1035153123 7:156892370-156892392 GCCCGCCCGCCTCTCGCGTTTGG - Intronic
1049547313 8:143239154-143239176 TCCCTCCTGCATGACGGGGTAGG - Intergenic
1055000846 9:71447228-71447250 TTCCACACGCAGCTCGGGGTGGG - Intergenic
1055308352 9:74952825-74952847 TCCGGGCCGCATCTCGGCGGCGG - Exonic
1055934063 9:81588773-81588795 TCCCGCCTGCTTCTGAGGGTGGG - Intronic
1058176175 9:101738315-101738337 TCCCGGCCGCCTCGCGGGGCCGG - Exonic
1060585007 9:124780339-124780361 TCCCTCCAGCATCAAGGGGTGGG + Intronic
1062080350 9:134620313-134620335 CCCTGCTTGCATCTCGGGGTGGG + Intergenic
1189821386 X:44873001-44873023 TCCCGCTCCCATCTCGGTGGCGG + Intergenic