ID: 1153285768

View in Genome Browser
Species Human (GRCh38)
Location 18:3452600-3452622
Sequence TCCTCGGCCTCAAGTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153285768_1153285770 15 Left 1153285768 18:3452600-3452622 CCTGTTTCACTTGAGGCCGAGGA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1153285770 18:3452638-3452660 AGCTACTTGCTTTTCCTCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 273
1153285768_1153285771 16 Left 1153285768 18:3452600-3452622 CCTGTTTCACTTGAGGCCGAGGA 0: 1
1: 0
2: 1
3: 5
4: 106
Right 1153285771 18:3452639-3452661 GCTACTTGCTTTTCCTCCTTGGG 0: 1
1: 0
2: 0
3: 69
4: 1237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153285768 Original CRISPR TCCTCGGCCTCAAGTGAAAC AGG (reversed) Intronic
900975613 1:6014332-6014354 CCCTGGGCTTCACGTGAAACTGG - Intronic
903887613 1:26549992-26550014 GCCTCGGCCTCACGAGTAACTGG + Intronic
904517532 1:31067820-31067842 GCCTCGGCCTCCAGAGTAACTGG - Intergenic
907069999 1:51525989-51526011 ACCTCAGCCTCCAGAGAAACTGG + Intergenic
908489377 1:64627702-64627724 CCCTCGGCCTCAAATAAAAGTGG - Intronic
914954799 1:152151946-152151968 TCCTGGGCCTCAAGATCAACAGG - Intergenic
918103774 1:181399021-181399043 TCCTCTGCCTCACATGAACCTGG + Intergenic
923768275 1:236913122-236913144 GCCTCGGCCTCCAGAGTAACAGG - Intergenic
1065025264 10:21534663-21534685 ACCTCGTCCTCCAGTGACACGGG - Exonic
1068087989 10:52398573-52398595 TCCTCAGCCTCCAGAGTAACTGG - Intergenic
1068846407 10:61680195-61680217 TCCTCAGCCTCCAGAGTAACTGG - Intronic
1075930772 10:126293444-126293466 TCCCTGGCCTCAAGTCAAACAGG + Intronic
1081534793 11:43988883-43988905 TCCTCGGCCTCTAGAGTAGCTGG + Intergenic
1093037094 12:14342271-14342293 GCCTCGGCCTCCAGAGAAACTGG - Intergenic
1093557232 12:20490876-20490898 TCCCCGGCCTCAAGTGATCCTGG - Intronic
1096300309 12:50421525-50421547 GCCTCAGCCTTAAGAGAAACTGG - Intronic
1097059551 12:56272373-56272395 TCCTCTGCCTGAGGTGCAACAGG + Exonic
1099156965 12:79189787-79189809 TCCTCAGCCTCCAGAGTAACTGG - Intronic
1102187835 12:110963693-110963715 GCCTCAGCCTCCAGTGTAACTGG + Intergenic
1102346881 12:112166405-112166427 TCCTGGGCCTCAGGTGAAGGAGG - Intronic
1103679998 12:122685810-122685832 TCCTCAGCCTCCAGAGTAACTGG - Intergenic
1106350512 13:28925086-28925108 TCCACGGCCTAAAGGCAAACAGG - Intronic
1108335841 13:49441450-49441472 TCCTCAGCCTCAAGAGTAGCTGG - Intronic
1111202932 13:84962476-84962498 TCCTGGGCCCCAAGTGCACCTGG + Intergenic
1112345832 13:98588382-98588404 GCCTCGGCCTCCAGTGTAGCTGG - Intergenic
1112396026 13:99032571-99032593 TCCTCTTCCTCAACTGAAAGGGG + Intronic
1113419964 13:110163552-110163574 TCCTCTGCCTCAGGTGTTACAGG - Exonic
1113574683 13:111386690-111386712 CACTGGGCTTCAAGTGAAACAGG - Intergenic
1115963454 14:38862333-38862355 TCCTCTGCTTCATGTGCAACTGG + Intergenic
1116889835 14:50257482-50257504 TCCTCGGCCTCCAGAGTAGCTGG + Intronic
1126095970 15:45091003-45091025 ACTTCTGCCTCAAGTGAAAGAGG - Intergenic
1129012570 15:72435701-72435723 ACCTCGGCCTCAAGAGTAGCTGG + Intergenic
1132460209 16:49321-49343 TCCTCGGCCTCATGAGTAGCTGG - Intronic
1134648584 16:15890335-15890357 TCCTCGGCCTCTGGAGTAACTGG - Intergenic
1135622228 16:23965907-23965929 TACTTGGACTCAAGTGACACTGG - Intronic
1138128990 16:54462776-54462798 GCCTCAGCCTCAAGTGTAGCTGG + Intergenic
1142030155 16:87834582-87834604 TCCTCTGCCCCAGGTGAACCTGG - Exonic
1142929579 17:3271241-3271263 TCCTCTCCCTTAAGTGAGACAGG - Intergenic
1143573552 17:7776349-7776371 GCCTCGGCCTCCTGAGAAACTGG - Intronic
1145008014 17:19348435-19348457 CCCTGGGCCTCACCTGAAACTGG - Intronic
1147767502 17:42846505-42846527 GCCTTAGCCTCAAGTGACACTGG + Intronic
1148968469 17:51458051-51458073 GCCTCAGCCTCCAGAGAAACTGG - Intergenic
1151757688 17:76083922-76083944 TCCTCTTCCTCAAGGGAAAAAGG - Intronic
1153285768 18:3452600-3452622 TCCTCGGCCTCAAGTGAAACAGG - Intronic
1154159456 18:11970222-11970244 GCCTCAGCCTCCAGTGTAACTGG + Intergenic
1154384316 18:13879862-13879884 TCCTGGGCCTCAAATGAGAATGG - Intergenic
1157697738 18:49736707-49736729 TTCTGTGCCTCAGGTGAAACGGG - Intergenic
1160932685 19:1578086-1578108 TCCTCGGCCCCACGTGAACCAGG - Exonic
1161094227 19:2379861-2379883 TCCTCAGCCTCAAGAGTAGCTGG + Intergenic
1162986476 19:14273598-14273620 TCCTCGGCCTCCAGAGTAGCCGG + Intergenic
1163563124 19:18032719-18032741 TCCTCAGCCTGAGGTGAAACAGG - Intergenic
1163939805 19:20481244-20481266 ACCTCAGCCTCAAGAGTAACTGG + Intergenic
1164931616 19:32180095-32180117 GCCTTGGCCTCCAGAGAAACTGG - Intergenic
1166154097 19:40897859-40897881 TCCTCAGCCTCCAGAGTAACTGG - Intronic
929185296 2:39087791-39087813 ACCTCGGCCTCTAGCGTAACTGG + Intronic
929431387 2:41890210-41890232 ACCTCAGCCTCAAGGGAATCTGG - Intergenic
930777788 2:55191885-55191907 TCCTCAGCCTCTAGAGTAACTGG - Intronic
932375822 2:71234885-71234907 GCCTCGGCCTCCAGAGTAACTGG - Intergenic
932502607 2:72197173-72197195 TCCTCGGGATCAAATGAAATGGG - Intronic
938009760 2:127819655-127819677 TACTCTGCCTCAAGTCAAAATGG + Intergenic
1169266265 20:4169060-4169082 TCCTCGGTCTCCAGTGTAGCTGG + Intronic
1169972233 20:11280310-11280332 GCCTCAGCCTCCAGTGTAACTGG - Intergenic
1172138236 20:32702570-32702592 TCCTGGGTCTCCAGTGAAATTGG - Intergenic
1174015374 20:47483923-47483945 GCCTCAGCCTCAAGAGTAACTGG + Intergenic
1174604199 20:51748849-51748871 CTCTTGGCCTCAAGTGAACCTGG - Intronic
1175147142 20:56905391-56905413 TGCTCGCCCATAAGTGAAACTGG - Intergenic
951250380 3:20387537-20387559 GCCTCGGCCTCCAGAGTAACTGG + Intergenic
951521479 3:23614918-23614940 GCCTCAGCCTCATGTGAAGCTGG + Intergenic
953149789 3:40314471-40314493 TCCTCGGCCTCAGGAGAGCCAGG - Intergenic
954366498 3:50149150-50149172 TCCTCGGCCTCCTGAGTAACTGG + Intergenic
959073710 3:101728372-101728394 GCCTCAGCCTCAAGAGTAACTGG + Intronic
964388043 3:156170068-156170090 TGCTTGGCCCCAAGAGAAACAGG - Intronic
966056587 3:175700247-175700269 TCAACGGCCTCAACTGAAGCTGG - Intronic
968542526 4:1175345-1175367 TCCTTGGCCTCCTGTGAGACTGG - Intronic
972587102 4:40447894-40447916 GCCTCGGCCTCCAGAGTAACTGG - Intronic
976978055 4:91187664-91187686 TCCTCAGCCTCATGAGAAGCTGG + Intronic
981818685 4:148860948-148860970 TCCTCAGTCTCAAATGCAACTGG - Intergenic
983956932 4:173709091-173709113 TCCTCGGCCTCCCGAGTAACTGG + Intergenic
984304588 4:177972139-177972161 TCATGGTCCTCAAGTGAAGCAGG - Intronic
988433642 5:31148608-31148630 TCCTCAGCCTCCAGAGTAACTGG - Intergenic
989410919 5:41119677-41119699 GCCTCAGCCTCAAGAGTAACTGG + Intergenic
989635727 5:43530905-43530927 TCTTGGGCCCCATGTGAAACAGG + Intronic
992700349 5:79335437-79335459 TCCTCGGCCTCACGAGTAGCTGG + Intergenic
997372422 5:133370494-133370516 TCCCAGGCCTGAAGGGAAACAGG + Intronic
997504337 5:134404898-134404920 GCCTCAGCCTCAAGAGTAACTGG + Intronic
998821763 5:146063743-146063765 GCCTCGGCCTCAAGAGTAGCTGG - Intronic
1002063383 5:176639810-176639832 TCCTCAGCCTCCCGAGAAACTGG - Intronic
1002137612 5:177117531-177117553 ACCTCGGCCTCCAGGGTAACTGG - Intergenic
1002452546 5:179327108-179327130 TCCTGGTTCTCAAGAGAAACTGG + Intronic
1003282576 6:4706672-4706694 TCCTCAGCCTCCAGAGTAACTGG - Intronic
1005110924 6:22280623-22280645 TCCTTTGCCTCCAGTGAAAGAGG - Intergenic
1010740879 6:79502993-79503015 GCCTCGGCCTCCCGAGAAACTGG + Intronic
1010744070 6:79541136-79541158 GCCTCAGCCTCACGTGAAGCTGG - Intergenic
1019785804 7:2976588-2976610 GCCTCGGCCTCCAGAGTAACTGG - Intronic
1023072848 7:36454725-36454747 GCCTCGGCCTCCTGAGAAACTGG + Intergenic
1024963515 7:55002979-55003001 TCCTCAGCCCCTAGTGTAACTGG + Intergenic
1030102686 7:105960513-105960535 TCCTGGGTCTCATGTGAAGCTGG + Intronic
1032602830 7:133317794-133317816 GCCTTGGCCTCAAGAGAAGCTGG + Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1037407833 8:18562772-18562794 GCCTCGGCCTCCAGTGCAATTGG - Intronic
1041572262 8:59351032-59351054 TCCTCAGCCTCCAGAGAAGCTGG - Intergenic
1041714206 8:60919427-60919449 TCTTTAGCTTCAAGTGAAACAGG + Intergenic
1042019532 8:64356638-64356660 GCCTCAGCCTCCAGAGAAACTGG + Intergenic
1043412233 8:80009499-80009521 TCCTCGGCCTCATGAGTAGCTGG - Intronic
1045353886 8:101367864-101367886 TCCTCAGCTTCAAGAGAAAACGG - Intergenic
1045367746 8:101492712-101492734 GCCTCAGCCTCTGGTGAAACTGG - Exonic
1047483802 8:125309763-125309785 TCCACGGCCTCATGTGAAACTGG - Intronic
1051028633 9:12646810-12646832 GCCTCGGCCTCCAGAGTAACTGG - Intergenic
1060414184 9:123419154-123419176 TCCTCAGCCTTTAGTGAACCTGG - Intronic
1061705152 9:132447398-132447420 TGCTAGGCTTCAAATGAAACTGG - Intronic
1188728231 X:33611435-33611457 TCCTAGGCCTGAAGGGAAAATGG + Intergenic
1201550721 Y:15213980-15214002 GCCTCAGCCTCCAGTGTAACTGG + Intergenic
1202190927 Y:22243692-22243714 CCCTCAGCCTCAAGAGTAACTGG + Intergenic