ID: 1153290152

View in Genome Browser
Species Human (GRCh38)
Location 18:3493034-3493056
Sequence CAGGAGCATGTTGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153290145_1153290152 8 Left 1153290145 18:3493003-3493025 CCTCCTCAGTAAAGGAAGCAGGA No data
Right 1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG No data
1153290142_1153290152 10 Left 1153290142 18:3493001-3493023 CCCCTCCTCAGTAAAGGAAGCAG No data
Right 1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG No data
1153290143_1153290152 9 Left 1153290143 18:3493002-3493024 CCCTCCTCAGTAAAGGAAGCAGG No data
Right 1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG No data
1153290146_1153290152 5 Left 1153290146 18:3493006-3493028 CCTCAGTAAAGGAAGCAGGACTT No data
Right 1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153290152 Original CRISPR CAGGAGCATGTTGAGGAGGA GGG Intergenic
No off target data available for this crispr