ID: 1153293940

View in Genome Browser
Species Human (GRCh38)
Location 18:3527881-3527903
Sequence TAAAATACCCCCACTGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153293940 Original CRISPR TAAAATACCCCCACTGGGCG TGG (reversed) Intronic
901434167 1:9235900-9235922 TAAAATACGCTGTCTGGGCGTGG - Intronic
902604824 1:17563173-17563195 TGGAATACCCACACTGGGCCAGG + Intronic
902948187 1:19859166-19859188 CAAAATAGCCCCAATGGGCTTGG + Intergenic
909181821 1:72433844-72433866 TAAAATCCCCACACTGGTTGGGG - Intergenic
910225459 1:84931728-84931750 TCAAAAACCCCCTCTGGGCCAGG + Intronic
914734427 1:150401931-150401953 AAAAAAAACCCCACTGGGCACGG - Intronic
915302476 1:154959428-154959450 CCAAATCCCCCCACTGGGCCCGG + Exonic
923842654 1:237690564-237690586 TAAAATACACACACAGGGCCAGG + Intronic
924267098 1:242293582-242293604 TCTAAGACCCCCAGTGGGCGTGG - Intronic
1065991316 10:31013022-31013044 TAAAAATCCCCAACTGGGCCGGG + Intronic
1070914013 10:80141301-80141323 TAAAATAACCCCCCTTGGCCTGG + Intronic
1073082244 10:100867590-100867612 TAAATCAGCCCCACTGGGCCAGG + Intergenic
1073491904 10:103857975-103857997 TTAAATACCCCAACTATGCGTGG + Intergenic
1074203366 10:111259330-111259352 TAAAATCCCTCCTCTGGGCCAGG + Intergenic
1074615367 10:115062036-115062058 TAAACTACAGCCACTGGGCCAGG + Intergenic
1075944853 10:126423999-126424021 TAAAATACCACCTCAGGGAGGGG - Intergenic
1076513873 10:131032348-131032370 TAAATCACCCTCACTTGGCGCGG - Intergenic
1083754312 11:64781798-64781820 TAAATTACCCAGACTGGGTGTGG + Intergenic
1087539316 11:99495077-99495099 TAAATCACCCCTGCTGGGCGTGG + Intronic
1089475143 11:118753631-118753653 TAAAATACCCACTCTGGGCCGGG - Intronic
1094326762 12:29248762-29248784 TAAACTGGCCCCGCTGGGCGTGG - Intronic
1095743971 12:45636708-45636730 AAAAATACCCCAGCTGGGTGGGG - Intergenic
1101071400 12:101079932-101079954 TGAAGTACCCACACTAGGCGTGG + Intronic
1102612908 12:114128356-114128378 TAGAATACCCCCATTCGGGGTGG - Intergenic
1104982521 12:132580515-132580537 TCAAATGCCCGCACTGGGAGAGG - Intronic
1110751970 13:79125028-79125050 TAAATTACACCCAGTGGGCTGGG - Intergenic
1114432088 14:22670507-22670529 TTAAATACTCCCACTGTGGGTGG - Intergenic
1114638564 14:24203468-24203490 TAAAACAGCTCCACTGGGCGCGG + Intronic
1115629083 14:35225640-35225662 TAAAATACACCAAGTGGGCCAGG - Intronic
1116567324 14:46465308-46465330 GAAAATATATCCACTGGGCGGGG - Intergenic
1118706433 14:68484650-68484672 GAAAATAGCCCAACTGGGCCAGG - Intronic
1119194752 14:72709114-72709136 GATACTACCCCCACTGGGTGTGG + Intronic
1120998660 14:90435819-90435841 CAAAATATCCACACTGGGCAGGG + Intergenic
1124083223 15:26520237-26520259 TTAAATTCCCTGACTGGGCGTGG + Intergenic
1127284160 15:57518007-57518029 AAAAATACCCCAGCTGGGCATGG + Intronic
1128040279 15:64566143-64566165 TAAAATACCTCAATTGGGCCAGG - Intronic
1128091905 15:64924929-64924951 TGAAATACACACACTGGGCCGGG + Intronic
1132213701 15:100047070-100047092 TAAAATGGCCCCCCTGGGTGTGG + Intronic
1137008813 16:35303198-35303220 TACAATACCCCTTCTGGGCAAGG + Intergenic
1142437533 16:90071422-90071444 TAAATTACCCACTCTGGGCCAGG - Intronic
1143440603 17:6970179-6970201 TAAAATTCCCCTGCTGGGCCAGG + Intronic
1144446440 17:15334051-15334073 TAAAATAAACCAGCTGGGCGTGG - Intronic
1146043676 17:29483332-29483354 TGAAATCCCCCCACTGCGGGAGG - Intronic
1146481683 17:33210057-33210079 TAAATGACCCCCAGTGGGTGGGG - Intronic
1148434363 17:47670963-47670985 TAAAAGAAACCCGCTGGGCGCGG + Intronic
1152156868 17:78639779-78639801 TAAAAGAACCCGGCTGGGCGCGG + Intergenic
1153154221 18:2130678-2130700 TAAAATACCACCCCTGGGCCTGG + Intergenic
1153293940 18:3527881-3527903 TAAAATACCCCCACTGGGCGTGG - Intronic
1162285130 19:9732750-9732772 AAAAATACCCACATTGGGCCGGG - Intergenic
1163059773 19:14752221-14752243 TATAATAGCCCGGCTGGGCGTGG - Intronic
1163329043 19:16624534-16624556 TAAAATAACCGCACAGGGCAGGG - Intronic
1163641281 19:18463681-18463703 TCAAAAACCCTCACTGGGCCAGG + Intronic
1164127395 19:22331106-22331128 TAAAATATCCCCTGTGGGCAGGG + Intergenic
1166066272 19:40361023-40361045 TGAAATCCCCGCACTGTGCGAGG + Intronic
1166071433 19:40390253-40390275 CAAGATTCCGCCACTGGGCGGGG - Intergenic
1166336719 19:42112663-42112685 TAAAATACGTCCCCTGGGCCGGG - Intronic
1166993836 19:46709654-46709676 GAAAATACCTCCACTGGGCCGGG - Intronic
1168341835 19:55628699-55628721 TGAAATACACGGACTGGGCGTGG - Intergenic
927454951 2:23241358-23241380 TGAAAGACCCAGACTGGGCGAGG - Intergenic
927658788 2:24974238-24974260 TAAAATATCACCACTGGGCATGG + Intergenic
935057731 2:99582143-99582165 GAAAAGACCCCGACCGGGCGTGG - Intronic
938697720 2:133849571-133849593 TAAAATAGCCCCTCTAGGTGTGG - Intergenic
939987414 2:148843982-148844004 TAAAATGGCCCTACTGGGCTGGG - Intergenic
942193075 2:173490214-173490236 TAAAATACCTCCTTTGGGCTAGG - Intergenic
1169136717 20:3202247-3202269 TAAAAAACCCTCTCTGGGCCGGG - Intronic
1172381317 20:34494959-34494981 AAAAATACATACACTGGGCGCGG + Intronic
1173581822 20:44152383-44152405 TAATATATCCCCACTGGGCACGG + Intronic
1181959672 22:26613932-26613954 TAAACTGGCCCCCCTGGGCGTGG + Intronic
1182263588 22:29094372-29094394 TGAAATACCCCAACGGGGAGGGG + Exonic
1182742857 22:32581405-32581427 TAAAATAGCCCCAGTTGGCCGGG - Intronic
1183654835 22:39178563-39178585 TAAAATAAACTCACTGGGCATGG + Intergenic
959118832 3:102208888-102208910 TAAACAGCCCCCCCTGGGCGTGG - Intronic
959944256 3:112110913-112110935 TTAAAGACCCCCAATGGGCTGGG + Intronic
971906895 4:32737448-32737470 TATAATCCCCCCACTGTGGGAGG - Intergenic
974004050 4:56538067-56538089 TAAAATACCCACTCTGGCTGCGG - Intronic
974197043 4:58588757-58588779 GAAAATATCTCTACTGGGCGTGG + Intergenic
982269567 4:153572624-153572646 TAAAATAACCAAACTGGGCCGGG - Intronic
982459801 4:155655156-155655178 TAAAAAATCCCCAGTGGGCCAGG + Intergenic
982634240 4:157872567-157872589 TAAAATATTCCCACTGTGCCTGG + Intergenic
987863546 5:23513584-23513606 TAAATTACCCACTCTGGGCCAGG + Intronic
991296525 5:65087113-65087135 TAAAATACTACCACTGTTCGGGG - Intergenic
995213648 5:109570258-109570280 TAAAATACCCGGGCTGGGCGCGG + Intergenic
997407495 5:133663323-133663345 TAAGATACTGCCACTGGGGGAGG + Intergenic
1004042898 6:11999006-11999028 TAAAATTCGCAGACTGGGCGTGG - Intergenic
1005152403 6:22767342-22767364 CAAAATACCACCACTAGGGGAGG + Intergenic
1006995134 6:38252809-38252831 TTAAAAACCCACACTGGGCCGGG + Intronic
1008449731 6:51636387-51636409 TAAAATAAACCAACTGGGTGTGG + Intronic
1009358875 6:62789530-62789552 TAAAACTCCCCTACTGGGAGAGG + Intergenic
1010651763 6:78463801-78463823 AAAAATACTCTCACCGGGCGCGG + Intergenic
1012112366 6:95252590-95252612 TAAAATACCAACACTAGGCCTGG - Intergenic
1013482713 6:110565983-110566005 AAAAATATCCCCGCTGGGTGTGG + Intergenic
1015531913 6:134229119-134229141 TACAAGACCCGCGCTGGGCGCGG - Intronic
1016130003 6:140456508-140456530 TAAAATACCCCCAAATGGCTAGG - Intergenic
1017158049 6:151340220-151340242 AAAAAAACCACCGCTGGGCGCGG - Intronic
1020109641 7:5440807-5440829 GAAAATACCACAACTGGGCCGGG - Intronic
1020964177 7:14844814-14844836 TAAAATCCCCCAGCTGGGCACGG + Intronic
1023016849 7:35976963-35976985 TAAACTGGCCCCACTGGGCGTGG - Intergenic
1024043153 7:45570386-45570408 TACAATAACACCACTGGGTGTGG - Intergenic
1026057362 7:66996344-66996366 TAAAATACCCCCAACCGGCCGGG - Intronic
1026236418 7:68530922-68530944 TAAAATACCAACACAGTGCGTGG - Intergenic
1026720751 7:72828708-72828730 TAAAATACCCCCAACCGGCCGGG + Intergenic
1026807611 7:73437835-73437857 TAAAGTGCCCACACTGGGCGTGG + Intergenic
1028280558 7:88921436-88921458 TAAAATACTCCCTTTGGGTGAGG - Intronic
1029667491 7:102005229-102005251 TAAAAAATCTCCACTGGGCCGGG + Intronic
1031054415 7:116977846-116977868 AAAAATACCACCACTCGGCCGGG - Intronic
1039257451 8:35734698-35734720 AGAAATACCCCAGCTGGGCGTGG - Intronic
1046162707 8:110388086-110388108 TAGAAAACCCCAGCTGGGCGCGG - Intergenic
1047761687 8:127959294-127959316 TAAAAGACCCAGGCTGGGCGCGG + Intergenic
1048498907 8:134958252-134958274 TAAAAAAGCCCCAGTGGGCCAGG + Intergenic
1050512576 9:6411902-6411924 TAAAATAAACCCACTTGGCCGGG + Intergenic
1059085530 9:111298365-111298387 TCAAATACACCCGCTGGGCTGGG + Intergenic
1187801205 X:23065115-23065137 TAAAAAATTCTCACTGGGCGTGG + Intergenic
1193858043 X:86629585-86629607 TAAAATATCACCAGTGGGCTGGG + Intronic